Research Article |
Corresponding author: Li-Na Zhang ( zhlina99@163.com ) Corresponding author: Ming-Xun Ren ( renmx@hainu.edu.cn ) Academic editor: Wen-Hong Chen
© 2020 Shao-Jun Ling, Xin-Ting Qin, Xi-Qiang Song, Li-Na Zhang, Ming-Xun Ren.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Ling S-J, Qin X-T, Song X-Q, Zhang L-N, Ren M-X (2020) Genetic delimitation of Oreocharis species from Hainan Island. In: Shui Y-M, Chen W-H, Ren M-X, Wen F, Hong X, Qiu Z-J, Wei Y-G, Kang M (Eds) Taxonomy of Gesneriaceae in China and Vietnam. PhytoKeys 157: 59-81. https://doi.org/10.3897/phytokeys.157.32427
|
Hainan Island harbours an extraordinary diversity of Gesneriaceae with 14 genera and 23 species, amongst which two species and one variety are recognised in the genus Oreocharis. These three Oreocharis taxa are all Hainan-endemics and show a complex geographical distribution pattern with considerable morphological intermixtures. In this study, we combined DNA (nuclear ITS sequences and cpDNA trnL-trnF and ycf1b) to evaluate genetic delimitation for 12 Oreocharis populations from the island, together with morphological similarity analysis using 16 morphological traits. The results showed Hainan Oreocharis taxa were monophyletic with relative low genetic diversity within populations, highly significant genetic differentiation amongst populations and a significant phylogeographical structure. The 12 populations formed three genetically distinct groups, roughly correspondent to the currently recognised two species and one unknown lineage. The PCA analyses of morphological traits indicate three distinctive groups, differing mainly in petal colour and corolla shapes. The roles of river and mountain isolations in the origin and distribution of these three lineages are discussed.
genetic differentiation, genetic diversity, morphological similarity, Oreocharis
Hainan Island is the largest tropical island in China, with an area of 33,920 km2. As a biodiversity hotspot in the world (
Interestingly, there are three recognised taxa of Oreocharis Bentham on Hainan Island (O. flavida Merrill, O. dasyantha Chun and O. dasyantha Chun var. ferruginosa Pan) and all are endemic to the island (
Here, we sampled 12 populations of Oreocharis taxa covering its entire distribution range on Hainan Island and examined their molecular phylogenetic relationships with one nuclear DNA fragment and two combined chloroplast DNA sequences separately. We also quantitatively analysed 16 morphological traits with principal component analysis (PCA). We aim to determine (1) whether or not the currently recognised three species or variety can be supported by genetic data (2) what factors (e.g. geographic isolation, pollination isolation, climate or intrinsic traits) are responsible for the evolution and maintenance of these Hainan-endemic Oreocharis?
Twelve geographic populations of Oreocharis taxa covering all the suitable habitats of the genus on the island were collected, including populations DW (Dongwu in Bawangling), DE (Donger in Bawangling), FT (Futou in Bawangling), NG (Nangao), HM (Mt. Houmi), JF (Mt. Jianfeng) and CH (Chahe at the foot of Mt. Jianfeng) from O. dasyantha, populations QX (Mt. Qixian), WZA (Wuzhi A in Mt. Wuzhi) and WZB (Wuzhi B in Mt. Wuzhi) from O. flavida and populations YG (Mt. Yingge) and LM (Mt. Limu) from unidentified Oreocharis sp. (Table
Sampled populations and nucleotypes/haplotypes information calculated from nrDNA and cpDNA of 12 Oreocharis populations. Private nucleotypes/haplotypes (nucleotype/haplotype occurs in only one population) are given in Bold.
Putative populations | Sampling site | Population | Longitude/ Latitude | Sampling size | Elevation (m) | ITS | trnL-F and ycf1b | ||||
---|---|---|---|---|---|---|---|---|---|---|---|
Haplotype (No. of individuals) | Hd | Pi × 103 | Haplotype (No. of individuals) | Hd | Pi × 103 | ||||||
O. dasyantha | Dongwu in Mt. Bawang | DW | 109°41'52"/ 18°53'55" | 17 | 1163 | H1(17) | 0 | 0 | H2(17) | 0 | 0 |
Donger in Mt. Bawang | DE | 109°10'27"/ 19°05'07" | 9 | 1011 | H1(9) | 0 | 0 | H2(7), H3(2) | 0.389 | 0.75 | |
Mt. Futou | FT | 109°41'01"/ 18°53'51" | 11 | 1200 | H1(11) | 0 | 0 | H2(11) | 0 | 0 | |
Mt. Nangao | NG | 109°19'06"/ 19°10'48" | 19 | 1350 | H1(19) | 0 | 0 | H2(18), H18(1) | 0.105 | 0.07 | |
O. dasyantha var. ferruginosa | Mt. Houmi | HM | 109°08'44"/ 18°53'50" | 51 | 1400 | H8(51) | 0 | 0 | H4(14), H5(1), H6(1), H7(29), H8(1), H9(1), H10(7) | 0.622 | 0.52 |
Mt. Jianfeng | JF | 108°52'43"/ 18°43'10" | 15 | 1100 | H8(15) | 0 | 0 | H11(15) | 0 | 0 | |
Riverside at Chahe | CH | 108°59'00"/ 18°44'30" | 10 | 300 | H9(9), H10(1) | 0.2 | 0.31 | H1(10) | 0 | 0 | |
O. flavida | Mt. Qixian | QX | 109°42'16"/ 18°42'41" | 17 | 1100 | H7(17) | 0 | 0 | H19(17) | 0 | 0 |
Mt. Wuzhi | WZA | 109°41'52"/ 18°53'55" | 32 | 1800 | H2(32) | 0 | 0 | H20(32) | 0 | 0 | |
Mt. Wuzhi | WZB | 109°41'29"/ 18°54'19" | 7 | 1058 | H2(1), H3(2), H4(1), H5(1), H6(2) | 0.905 | 2.51 | H20(4), H21(3) | 0.571 | 0.37 | |
Oreocharis sp. | Mt. Yingge | YG | 109°33'06"/ 19°02'21" | 16 | 1249 | H11(1), H12(10), H13(3), H14(1), H15(1) | 0.6 | 1.92 | H22(11), H23(5) | 0.458 | 0.29 |
Mt. Limu | LM | 109°44'44"/ 19°10'10" | 34 | 1350 | H12(27), H16(7) | 0.337 | 0.52 | H12(26), H13(1),H14(3), H15(2), H16(1), H17(1) | 0.414 | 0.49 | |
Sum | 238 | 2.042 | 5.26 | 2.559 | 2.49 |
Total genomic DNA for each individual was extracted using CTAB methods (
One nuclear ribosomal DNA (nrDNA) sequence, the ITS region comprising spacer 1, the 5.8S gene and spacer 2 (
Primers used for DNA amplification of Oreocharis taxa and genetic diversity. S, polymorphic sites, h, number of haplotypes, Hd, haplotypes diversity, π, nucleotide diversity, K, average number of nucleotide difference.
DNA fragment | Primers sequences | S | h | Hd | π | K | Fragment size | Tajima’s D | Fu’s Fs | Reference |
---|---|---|---|---|---|---|---|---|---|---|
ITS | ITS4: 5’TCCTCCGCTTATTGATATGC 3’ | 56 | 16 | 0.820 | 0.02178 | 14.067 | 670 bp | 1.53380 | 17.662*** |
|
ITS5 HP: 5’GGAAGGAGAAGTCGTAACAAGG 3’ | ||||||||||
trnL-F | c: 5’CGAAATCGGTAGC GCTACG 3’ | 16 | 11 | 0.805 | 0.00428 | 3.460 | 843 bp | 0.77872 | 2.529 | Taberlet 1991 |
f: 5’ATTTGAACTGGTGA CACGAG 3’ | ||||||||||
ycf1b | ycf1bF: 5’ACATATG CCAAAGTGATGGAAAA 3’ | 29 | 12 | 0.871 | 0.01243 | 8.890 | 725 bp | 2.05208 | 12.821*** |
|
ycf1bR: 5’CCTCGCCGAAAATCTGATTGTTGTGAAT 3’ | ||||||||||
trnL-F and ycf1b | 55 | 23 | 0.887 | 0.00845 | 13.214 | 1568 bp | 1.33642 | 8.426* |
In order to explore the systematic position of Oreocharis taxa in Hainan Island, we followed
The original chromatograms from both directions of the ITS and cpDNA sequences obtained were evaluated with the software BioEdit (
The number of nucleotypes/haplotypes, number of nucleotypes/polymorphic sites (S), nucleotype/haplotype diversity (h), nucleotide diversity (π) and measures of DNA divergence (K) values were analysed by the programme DNASP v. 6.12.01 (
Genetic diversity within populations (Hs;
The Analysis of Molecular Variance (AMOVA) was conducted to estimate genetic variation which was assigned within and amongst populations using GENALEX v. 6.503 (
Phylogenetic relationships of nucleotypes/haplotypes were inferred with BI using MrBayes v. 3.2.6 (
Prior to Bayesian analysis, the optimal model of nucleotide substitution was detected for each gene using MRMODELTEST v. 2.3 (
All sequences of each population were chosen to represent effective geographic populations themselves. The method for the Neighbour-joining (NJ) tree was selected to build the phylogenetic relationship of Oreocharis taxa populations in Hainan Island by MEGA v.6.5, with Kimura two-parameter model (
A Bayesian clustering approach conducted in STRUCTURE v. 2.3.4 (
To detect whether there was local genetic variation under geographically limited dispersal, isolation by distance (IBD) for each population was tested by a Mantel test in GENALEX between pairwise genetic distance (uncorrected sequence divergence (Dxy) for nuclear DNA and cpDNA) and geographical distance.
To characterise phenotype diversity and differences amongst populations, we measured and observed 16 morphological characters, including floral and leaf traits of at least 30 individuals for each population. The measured floral traits were, (i) corolla colour (yellow tube with orange lip, yellow, orange), (ii) corolla shape and type (tubular, thin tubular, campanulate), (iii) corolla width (< 1.49 cm, 1.5 cm - 1.99 cm, > 2.0 cm), (iv) corolla mouth width (< 0.5 cm, > 0.5 cm), (v) floral tube length (< 0.99 cm, 1 cm - 1.49 cm, > 1.5 cm), (vi) sepal length (short, long) and (vii) number of petals (five, six).
Five stamen traits were included in the analyses: (i) anther position (included-anthers hidden inside the floral tube, floral throat-anthers lying in the throat of floral tube, exerted-anthers are exposed outside the floral tube), (ii) stamen type (monomorphic, didynamous), (iii) pollen presentation (simultaneous, separately for each pair), (iv) anther shape (oval, horseshoe) and (v) hair on filament (absent, present).
Two stigma characters and two leaf traits were also included in the analyses: (i) location of stigma (included-stigma hidden inside the floral tube, throat-stigma lying in the throat of floral tube, exerted-stigma is exposed outside the floral tube), (ii) number of stigma (one, two), (iii) serration of leaf edge (present, absent) and (iv) leaf epidermal hair in abaxial side (absent, present). Measurements were taken with a rectilinear scale and rounded to the nearest 0.1 mm.
Principal Component Analysis (PCA) was conducted in SPSS v. 19.0 (
The combined ITS1/2 and trnL-F datasets of Hainan Oreocharis taxa with other 57 Oreocharis species were 568 and 871 bp long, amongst which 233 and 89 were polymorphic sites and 141 and 38 were parsimony informative sites, respectively. The aligned dataset was 1439 bp long with a total number of 305 polymorphic sites measured, of which 160 were parsimony informative sites. There was no significant incongruence, based on the incongruence length difference (ILD) test between the ITS1/2 and trnL-F (p > 0.05).
Both the BI and ML analysis showed Hainan Oreocharis taxa being monophyly with PP (posterior probability) = 0.79 and BS (bootstrap value) = 38% (Appendix
The aligned ITS sequence matrix comprised in total of 670 basepairs (bp). A total number of 56 polymorphic sites were present, of which 48 were parsimony-informative, which allowed the identification of 16 different nucleotypes from a size of 238 samples (Table
The combined alignment of the two cpDNA regions was in total 1615 bp long (858 and 757 bp for trnL-trnF and ycf1b, respectively) with a significant rate of homogeneity (P = 1) in the congruency test, indicating that there was no significant difference in the laboratory between the two cpDNA regions. The alignment contained 55 polymorphic sites and 8 indels (Table
Haplotypes diversity (Hd) and nucleotide diversity (Pi) for each population are summarized in Table
In total, the average intrapopulation diversity HS was lower than the genetic diversity HT. Both in ITS and cpDNA sequences, total gene diversity index (NST) was not significantly greater than the genetic differentiation index within populations (GST, P > 0.05), revealing that Hainan Oreocharis taxa have no correspondence between haplotype comparability and geographic distribution (Appendix
The AMOVA indicated that almost all variation (99% and 97%) was partitioned amongst populations, which was higher than the variation (1% and 3%) within populations, based on the ITS and cpDNA data, respectively, revealing highly significant genetic differentiation amongst populations (Table
Genetic diversity and Analysis of Molecular Variance (AMOVA) based on the ITS and combined trnL-F and ycf1b sequences in Oreocharis taxa.
DNA fragment | HS | HT | GST | NST | Source of variation | d.f. | Sum of squares | Variance components | Percentage of variation (%) | F ST | r |
---|---|---|---|---|---|---|---|---|---|---|---|
ITS | 0.170 | 0.884 | 0.808 | 0.982 | Amongst populations | 11 | 2353.579 | 213.962 | 11.176 | 99% | |
Within populations | 226 | 28.698 | 0.127 | 0.127 | 1% | 2382.277 | |||||
cpDNA | 0.215 | 0.913 | 0.765 | 0.977 | Amongst populations | 11 | 2497.917 | 227.083 | 11.848 | 97% | |
Within populations | 226 | 88.752 | 0.393 | 0.393 | 3% | 2586.668 |
Both phylogenetic trees, based on ITS nucleotypes and cpDNA haplotypes, indicated that nucleotypes/haplotypes can be separated into three main groups with strong bayesian probabilities (> 0.95) (Figs
Bayesian Inference tree (a) using MrBayes and network (b) showing the genetic relationships amongst the observed ITS nucleotypes of Hainan Oreocharis populations. Numbers on branches indicate the bootstrap values for MP/MB and posterior probability. The relative sizes of the circles in the network are proportional to the nucleotype frequencies and missing nucleotypes are represented by a small black spot.
The results of the NJ tree, based on nrDNA and cpDNA, suggested 12 populations were clearly clustered into three major groups, which well corresponded to the three defined Oreocharis taxa in Hainan Island, i.e. O. dasyantha (includes O. dasyantha var. ferruginosa), O. flavida and Oreocharis sp. Additionally, the analyses also presented a close relationship between O. flavida and Oreocharis sp., then with O. dasyantha.
Bayesian Inference tree (a) and network (b) of trnL-F and ycf1b haplotypes of Oreocharis populations in Hainan Island. Posterior probabilities are given above branches. The relative sizes of the circles in the network are proportional to the haplotype frequencies and missing haplotypes are represented by a small black spot.
Although the signal was stronger for cpDNA (Rxy = 0.473, P < 0.001) than for nuclear DNA (Rxy = 0.257, P < 0.001), the relationship between genetic and geographical distance for 12 populations was significant both in nuclear DNA and cpDNA (Appendix
According to the floral syndromes, the Principal Component Analysis of 16 floral characters of Hainan Oreocharis populations can be divided into three clusters (Fig.
The phylogenetic tree showed that Hainan Oreocharis taxa are monophyly (Appendix
Most Oreocharis populations hold very low nucleotide and haplotype diversity (Table
Mountains can also probably explain such observed pattern with geographic isolation of these groups. Almost all Oreocharis populations in Hainan Island were restricted in > 1000 m high-elevation mountains with massive humidity, such that the island-like habitat became fragmented caused by a deep and wide valley in the complicated mountains system, which resulted in blocking of gene flow of Oreocharis populations with weak seed dispersal ability even at the fine scale (
Secondly, the ‘sky island’ caused by high mountains may also cause such genetic differentiation for montane species (
According to morphological traits, all the 12 Oreocharis populations were also grouped into three clusters and corolla colour, shape and types are the main characters for distinguishing groups (Fig.
This work was funded by Innovative Team Program of Hainan Natural Science Foundation (2018CXTD331), National Natural Science Foundation of China (31670230 and 41871041), the Postgraduate Innovation Project of Biological Science of Tropical Agriculture and Forest Institute, Hainan University. We thank Mt. Bing-Qi Li from Mt. Limu Nature Reserve and staff of Bawangling and Yinggeling National Nature Reserve for providing help in the field.
Molecular phylogeny for Hainan Oreocharis taxa and 57 Oreocharis species based on combined ITS1/2 and trnL-trnF, there was no significant incongruence based on the incongruence length different (ILD) test between the ITS1/2 and trnL-trnF. Bayesian posterior probability (PP) and ML bootstrap values (BS) are showed above branches. Hainan Oreocharis taxa were showed in grey.
List of Hainan Oreocharis taxa and 57 Oreocharis species used in the phylogenetic analysis, including respective Genbank accession and voucher numbers.
Species | trnL-trnF | ITS1/2 | Voucher number |
---|---|---|---|
Oreocharis acaulis (Merr.) Mich.Möller & A.Weber | HQ633012 | HQ632916 | M.Möller MMO 09-1605 |
Oreocharis amabilis Dunn | KM232654.1 | KJ475433.1 | Carles 587 |
Oreocharis argyreia Chun ex Pan | HQ632919.1 | HQ633015.1 | M.Möller MMO 07-1131 |
Oreocharis aurea Dunn | KM062914.1 | KM063154.1 | M.Möller MMO 06-980 |
Oreocharis auricula (S.Moore) C.B.Clarke | FJ501482.1 | DQ912664.1 | M.Möller MMO 03-304 |
Oreocharis begoniifolia (H.W.Li) Mich.Möller & A.Weber | KM062926.1 | KM063166.1 | M.Möller MMO 08-1221 |
Oreocharis benthamii C.B.Clarke | JF697584.1 | JF697572.1 | M.Möller MMO 08-1317 |
Oreocharis brachypodus J.M. Li & Z.M.Li | KR476564.1 | KR337019.1 | Jia-Mei Li 2304 |
Oreocharis burttii (W.T.Wang) Mich.Möller & A.Weber | JF697582.1 | JF697570.1 | F.Wen 2010-05 |
Oreocharis chienii (Chun) Mich.Möller & A.Weber | KM062908.1 | KM063148.1 | JXU0008123 |
Oreocharis cinnamomea Anthony | KM062921.1 | KM063161.1 | PE-02053073 |
Oreocharis concava (Craib) Mich.Möller & A.Weber | KM062930.1 | KM063170.1 | PE-02053062 |
Oreocharis convexa (Craib) Mich.Möller & A.Weber | FJ501337.1 | FJ501506.1 | M.Möller MMO 01-176 |
Oreocharis cordatula (Craib) Pellegrin | KM062922.1 | KM063162.1 | PE-02053432 |
Oreocharis cotinifolia (W.T.Wang) Mich.Möller & A.Weber | HQ632914 | HQ633010 | Q.M.Chuan 01 |
Oreocharis craibii Mich.Möller & A.Weber | HQ632921 | HQ633017 | M.Möller MMO 07-1072 |
Oreocharis dalzielii (W.W.Sm.) Mich.Möller & A.Weber | JF697571 | JF69783 | F.Wen 2010-06 |
Oreocharis dentata A.L.Weitzman & L.E.Skog | KM062916.1 | KM063156.1 | GH00353683 |
Oreocharis dimorphosepala (W.H. Chen & Y.M. Shui) Mich.Möller | KM062925.1 | KM063165.1 | Y. M.Shui & al. 85333 |
Oreocharis dinghushanensis (W.T.Wang) Mich.Möller & A.Weber | GU350643 | GU350675 | Lin Q.B. LQB06-01 |
Oreocharis duyunensis Z.Y. Li, X.G. Xiang &Z.Y. Guo | MG722858.1 | MG722856.1 | PE-02114626 |
Oreocharis elliptica Anthony | KM063155.1 | KM062915.1 | CDBI0130369 |
Oreocharis esquirolii Léveillé | HQ633011 | HQ632915 | D.W.Zhang 723 |
Oreocharis eximia (Chun ex K.Y.Pan) Mich.Möller & A.Weber | KM062919.1 | KM063159.1 | PE-02052811 |
Oreocharis farreri (Craib) Mich.Möller & A.Weber | JF697585 | JF697573 | Zhou Ping ZP 2010-020 |
Oreocharis georgei Anthony | KM062917.1 | KM063157.1 | PE-02053075 |
Oreocharis hekouensis (Y.M.Shui & W.H.Chen) Mich.Möller & A.Weber | KM062934.1 | KM063174.1 | KUN-1219106 |
Oreocharis henryana Oliver | JF697586.1 | JF697574.1 | CSH0017984 |
Oreocharis heterandra D.Fang & D.H.Qin | KM232655.1 | KJ475432.1 | PE-02052999 |
Oreocharis hirsuta Barnett | KM062913.1 | KM063153.1 | Put 3428 |
Oreocharis humilis (W.T.Wang) Mich.Möller & A.Weber | GU350633 | GU350665 | Liang R.H.SC-YB |
Oreocharis jiangxiensis (W.T.Wang) Mich.Möller & A.Weber | HQ633029 | HQ632933 | M.Möller MMO 09-1451 |
Oreocharis jinpingensis W. H. Chen & Y. M. | KM062923.1 | KM063163.1 | Y.M. Shui et al. 91309 |
Oreocharis lancifolia (Franch.) Mich.Möller & A.Weber | HQ632924 | HQ633020 | M.Möller and P.Zhou MMO 09-1624 |
Oreocharis leiophylla Wang | GU350676 | GU350644 | Zhou X.R. ZXR-05-01 |
Oreocharis longifolia (Craib) Mich.Möller & A.Weber | HQ632934 | HQ633030 | M.Möller MMO 08-1239 |
Oreocharis lungshengensis (W.T.Wang) Mich.Möller & A.Weber | HQ632917 | HQ633013 | M.Möller MMO 06-916 |
Oreocharis magnidens Chun ex Pan | HQ632930.1 | HQ633026.1 | PE-02052989 |
Oreocharis mileensis (W.T.Wang) Mich.Möller & A.Weber | KM063145.1 | KM063182.1 | KUN-1385472 |
Oreocharis muscicola (Craib) Mich.Möller & A.Weber | DQ912665 | FJ501548 | Kew (1995-2229) |
Oreocharis nanchuanica (K.Y.Pan & Z.Y.Liu) Mich.Möller & A.Weber | KM062924.1 | KM063164.1 | KUN-1385365 |
Oreocharis pankaiyuae Mich.Möller & A.Weber | HQ632925 | HQ633021 | PE-02053064 |
Oreocharis primuliflora (Batalin) Mich.Möller & A.Weber | HQ633019 | HQ932923 | PE-02053071 |
Oreocharis primuloides (Miq.) Benth. & Hook.f. ex Clarke | FJ501546.1 | FJ501364.1 | PE-01270488 |
Oreocharis rhombifolia (K.Y.Pan) Mich.Möller & A.Weber | GU350632 | GU350664 | PE-02053532 |
Oreocharis ronganensis (K.Y.Pan) Mich.Möller & A.Weber | HQ633023 | HQ632927 | PE-00030693 |
Oreocharis rosthornii (Diels) Mich.Möller & A.Weber | KM062928.1 | KM063168.1 | ZY0001346 |
Oreocharis rotundifolia Pan | KM062911.1 | KM063151.1 | PE-00030861 |
Oreocharis saxatilis (Hemsl.) Mich.Möller & A.Weber | KM062932.1 | KM063172.1 | JIU05295 |
Oreocharis sericea Léveillé | KM232656.1 | KJ475407.1 | CSFI059560 |
Oreocharis sinensis (Oliv.) Mich.Möller & A.Weber | HQ632912 | HQ633008 | IBSC-0548658 |
Oreocharis sinohenryi (Chun) Mich.Möller & A.Weber | HQ632913.1 | HQ633009.1 | M.Möller MMO 07-1150 |
Oreocharis speciosa (Hemsl.) Mich.Möller & W.H. Chen | KM062909.1 | KM063149.1 | K000858093 |
Oreocharis stewardii (Chun) Mich.Möller & A.Weber | HQ632926 | HQ633022 | M.Möller MMO 06-917 |
Oreocharis urceolata (K.Y.Pan) Mich.Möller & A.Weber | KM062920.1 | KM063160.1 | M.Möller MMO 09-1633 |
Oreocharis wangwentsaii Mich.Möller & A.Weber | GU350658 | GU350689 | Liang R.H.YN-Qj |
Oreocharis xiangguiensis W.T.Wang & K.Y.Pan | HQ632932.1 | HQ633028.1 | JIU04686 |
Oreocharis dasyantha Chun | MK587993 | MK587954 | S.Jun Ling 20181124-02 |
Oreocharis flavida Merr. | MK587990 | MK587947 | S.Jun Ling 20181126-01 |
Oreocharis dasyantha Chun var. ferruginosa K.Y. Pan | MK587992 | MK587956 | S.Jun Ling 20181124-05 |
Oreocharis sp. | MK587948 | MK587987 | S.Jun Ling 20181205-01 |
DW | DE | FT | NG | HM | JF | CH | WZA | WZB | QX | YG | LM | Total Variance Explained | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
corolla color, coded as (0) yellow with orange, (1) yellow, (2) orange | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 | 2 | 2 | 1 | 1 | 45.406% |
corolla shape and type, coded as (0) conical, (1) thin tubular, (2) campanulate | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 2 | 2 | 2 | 1 | 1 | 34.040% |
corolla size, coded as (0) <1.49 cm, (1) 1.5 cm<-<1.99 cm, (2) >2.0 cm | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 2 | 2 | 0 |
corolla mouse width, coded as (0) <0.5 cm, (1) >0.5cm | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 0 | 0 |
length of tube, coded as (0) <0.99 cm, (1) 1 cm <-<1.49 cm, (2) >1.5 cm | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 1 | 1 | 0 | 1 | 1 | 5.272% |
length of sepal, coded as (0)short, (1) long | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 |
number of petal, coded as (0) five, (1) six | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 |
location of stamens, coded as (0) included, (1) throat and (2) exerted | 2 | 2 | 2 | 2 | 2 | 0 | 2 | 0 | 0 | 0 | 1 | 1 | 0 |
types of stamens, coded as (0) equal length, (1) didynamous stamens | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 1 | 0 |
pollen presentation, coded as (0) simultaneous, (1) separated | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
anther shape, coded as (0) oval shape, (1) horseshoe stage | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 0 |
hair on stamen, coded as (0) absent, (1) exist | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 0 | 0 | 0 |
location of stigma, coded as (0) included, (1) throat and (2) exerted | 2 | 2 | 2 | 2 | 2 | 1 | 2 | 0 | 0 | 0 | 0 | 0 | 9.293% |
number of stigma, coded as (0) one, (1) two | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 |
serration pf leaves edge, ceded as (0) absent, (1) exist | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 | 1 | 3.280% |
leaf epiderrmal hair on abaxial side , ceded as (0) absent, (1) exist | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 1 | 1 | 0 |