Research Article |
Corresponding author: Zheng-Yu Zuo ( zuozhengyu@mail.kib.ac.cn ) Corresponding author: Fang Wen ( wenfang760608@139.com ) Academic editor: Alan Paton
© 2023 Guo-Liang Xu, Li-Fen Liang, Di-Ya Chen, Zhi-Fang Jing, Xiao-Hai Zuo, Zheng-Yu Zuo, Fang Wen.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Xu G-L, Liang L-F, Chen D-Y, Jing Z-F, Zuo X-H, Zuo Z-Y, Wen F (2023) Primulina jiulianshanensis, a new species of Gesneriaceae from Jiangxi Province, China. PhytoKeys 226: 1-16. https://doi.org/10.3897/phytokeys.226.96351
|
Primulina jiulianshanensis F.Wen & G.L.Xu, a new species of Gesneriaceae from Jiulianshan National Nature Reserve of Jiangxi Province, China, is described and illustrated here. Molecular evidence showed it was sister to P. wenii Jian Li & L.J.Yan, while the morphological observation found clear differences between them, petiole, both sides of leaf blades, adaxial surface of the calyx lobes, corolla inside toward the bottom, bract margins covered glandular-pubescent hairs in P. jiulianshanensis (vs. no glandular-pubescent hairs in P. wenii); lateral bracts 4–9 × ca. 2 mm, the central one 2–5 × 1–1.5 mm, adaxially glabrous but sparsely pubescent at apex (vs. lateral bracts 14–16 × 2.5–3.0 mm, the central one 10–12 × 1.3–1.6 mm, all adaxially pubescent); calyx lobes 8–11 × ca. 2 mm, each side with several brown serrate teeth at apex (vs. 14–15 × ca. 2.5 mm, margin entire); filaments and staminodes sparsely yellow glandular-puberulent (vs. white, glabrous).
Flora of Jiangxi, Jiulianshan National Nature Reserve, new taxon, Primulina wenii, taxonomy
The genus Primulina Hance (
Jiangxi Province is located in the mid-subtropical region of East China; the species number of Primulina is not very rich. After consulting references, checking herbarium specimens, and excluding the species that have been mistakenly identified, only 13 species of Primulina have been confirmed in Jiangxi Province (
In April 2021, an interesting population of Primulina was found on a cliff of Danxia landform under the evergreen broad-leaved forest in Jiulianshan National Nature Reserve, Longnan City, Jiangxi Province. Morphologically, this species is similar to P. wenii Jian Li & L.J.Yan (
We collected the plants at the flowering and fruiting stage in the type locality to make specimens, and at the same time carried out botanical fine anatomical photography to observe carefully. We saw that the indumentum characters of petiole, leaf, bract, calyx, corolla tube, filaments, staminodes of this unknown species were obviously different from P. wenii, and the differences of two species’ calyx lobes and bracts characters can help us easily distinguish them. In order to understand the phylogenetic placements of this unknown species in Primulina, ITS and trnL-F sequences of this species were amplified and included for phylogenetic analysis to examine the relationships of the putative new species.
All available specimens of Primulina were used and compared (i. e. those stored in the following herbaria ANU, HITBC, IBK, IBSC, KUN, PE), as was the material of Primulina from recent fieldwork by the authors’ team in South and Southwest China. All the morphological characters, such as leaves, inflorescences, flowers and capsules, were observed and measured in the field. The description, measurements, shape, color and other details given in this description are based on living plants and specimens. We examined distinguished morphological characters of the presumed new species and the compared one, P. wenii, under a dissecting microscope. We described this presumed new species using the terminology of
We randomly selected one plant from the population to collect its leaves for a DNA experiment. Fresh leaf materials were preserved in silica gel for quick drying. Total genomic DNA was extracted from dried leaves using modified cetyltrimethylammonium bromide (CTAB) protocol (
Species names and GenBank accession numbers of ITS and trnL-F DNA sequences used in this study.
Species name | Voucher number | ITS | trnL-F |
---|---|---|---|
Petrocodon ainsliifolius | CWH88 | KF202291 | KF202298 |
Petrocodon hancei | CIPeng22903 | KY796057 | KY796059 |
Primulina alutacea | YD07 | KY394847 | KY393441 |
Primulina argentea | YMBC | KY394848 | KY393442 |
Primulina baishouensis | GXLG05 | KY394849 | KY393443 |
Primulina balansae | BALAN | MK747141 | MK746274 |
Primulina beiliuensis | GXBLBC | KY394850 | KY393444 |
Primulina beiliuensis var. fimbribracteata | SGQJ04 | KY394851 | KY393445 |
Primulina bicolor | SLHLCB | KY394852 | KY393446 |
Primulina bipinnatifida | GXLG04 | KY394853 | KY393447 |
Primulina bobaiensis | BBGL01 | KY394854 | KY393448 |
Primulina bogneriana | WF7 | MK747166 | MK746225 |
Primulina brachytricha | DWDMCZ | KF498048 | KY393450 |
Primulina brachytricha var. magnibracteata | KFC4193 | MK369979 | MK369994 |
Primulina brunnea | BRUN | MK747142 | MK746275 |
Primulina bullata | GXJX06 | KF498071 | KY393451 |
Primulina cangwuensis | GXLG04 | KY394853 | KY393447 |
Primulina cardaminifolia | GXLB | MK747131 | MK746255 |
Primulina carinata | NTBC | KY394858 | KY393452 |
Primulina cataractarum | N1 | MW900263 | MW960358 |
Primulina chizhouensis | JXFY01 | KY394860 | KY393454 |
Primulina colaniae | WF8 | MK747167 | MK746224 |
Primulina confertiflora | GDYS05 | MK747101 | MK746253 |
Primulina cordata | HYH010 | KC190200 | KC190207 |
Primulina cordifolia | GXRA02 | KY394863 | KY393457 |
Primulina cordistigma | GDYCXZ | MK747118 | MK746251 |
Primulina crassirhizoma | CJGL01 | KY394864 | KY393458 |
Primulina crassituba | HNSP | MK747147 | MK746230 |
Primulina curvituba | GXHJ01 | MK747137 | MK746242 |
Primulina danxiaensis | P22865 | JX506886 | JX506778 |
Primulina debaoensis | DBGL01 | KY394868 | KY393462 |
Primulina depressa | DXS02 | KY394869 | KY393463 |
Primulina diffusa | PJGL01 | KY394871 | KY393465 |
Primulina dongguanica | DGBC | KY394872 | KY393466 |
Primulina drakei | YNCP01 | KY394873 | KY393467 |
Primulina dryas | HKDMS | KY394875 | KY393469 |
Primulina duanensis | DABC | KY394877 | KY393471 |
Primulina eburnea | P22908 | JX506891 | JX506783 |
Primulina effusa | KFC4167 | MK369976 | MK369991 |
Primulina fengkaiensis | KFC4130 | MK369975 | MK369990 |
Primulina fengshanensis | KFC4195 | MK369970 | MK369985 |
Primulina fimbrisepala | P22863 | JX506894 | JX506786 |
Primulina fimbrisepala var. mollis | GXIB | JX506895 | JX506787 |
Primulina flavimaculata | KFC3988 | MK369974 | MK369989 |
Primulina floribunda | DHGL01 | KY394886 | KY393480 |
Primulina fordii | LJM1207202 | MG727881 | MG727878 |
Primulina fordii var. dolichotricha | DHS01 | MK747125 | MK746247 |
Primulina gemella | GEME | MK747146 | MK746254 |
Primulina glabrescens | GZLBSM | MK747132 | MK746278 |
Primulina glandaceistriata | GXLCHW | MK747114 | MK746256 |
Primulina glandulosa | GXPLCG | KY394887 | KY393481 |
Primulina gongchengensis | GCGL01 | KY394889 | KY393483 |
Primulina grandibracteata | YNHK | MK747121 | MK746266 |
Primulina guigangensis | GXGGBC | KY394892 | KY393486 |
Primulina guihaiensis | GXLG036 | KY394893 | KY393487 |
Primulina guizhongensis | GXGZBC | KY394894 | KY393488 |
Primulina halongensis | HLW01 | KY394895 | KY393489 |
Primulina hedyotidea | XWB | JX506905 | JX506797 |
Primulina heterochroa | GXMES01 | KY394898 | KY393492 |
Primulina heterotricha | HNBT01 | KY394899 | KY393493 |
Primulina hezhouensis | HZXH | MK747143 | MK746258 |
Primulina hiepii | WF2 | MK747144 | MK746223 |
Primulina hochiensis | GXIB | JX506903 | JX506795 |
Primulina huaijiensis | GDHJ02 | KF498127 | KY393495 |
Primulina huangii | WF12 | MK747138 | MK746231 |
Primulina hunanensis | Xu11697 | KU220602 | KU220608 |
Primulina jiangyongensis | HNJY01 | KY394902 | KY393496 |
Primulina jingxiensis | LZXHGL01 | KY394903 | KY393497 |
Primulina jiuwanshanica | JWS | MK747116 | MK746260 |
Primulina juliae | LJM1210011 | MG727889 | MG727873 |
Primulina langshanica | LSCZ | KY394907 | KY393501 |
Primulina latinervis | XIN1 | KY394908 | KY393502 |
Primulina laxiflora | P22927 | JX506910 | JX506802 |
Primulina lechangensis | GDLC12 | KY394910 | KY393504 |
Primulina leeii | LSGL01 | KY394911 | KY393505 |
Primulina leiophylla | GXJX07 | KY394912 | KY393506 |
Primulina lepingensis | JXLP01 | KY394913 | KY394913 |
Primulina leprosa | GXMS055 | KY394914 | KY393508 |
Primulina lianpingensis | CHLT016 | MH343910 | MH344542 |
Primulina liboensis | GXJX08 | KY394917 | KY393511 |
Primulina liguliformis | GXIB | JX506912 | JX506804 |
Primulina lijiangensis | GLS01 | KY394919 | KY393513 |
Primulina linearicalyx | KFC4141 | MH032854 | MH032841 |
Primulina linearifolia | GXNN01 | KY394921 | KY393515 |
Primulina lingchuanensis | LCXHGL01 | KY394922 | KY393516 |
Primulina linglingensis | LLBC | KY394923 | KY393517 |
Primulina linglingensis var. fragrans | XHLLBC2 | MK746285 | MK746285 |
Primulina liujiangensis | LJGL01 | KY394924 | KY393518 |
Primulina lobulata | GDQX04 | KF498054 | KY393519 |
Primulina longgangensis | P22948 | JX506916 | JX506808 |
Primulina longicalyx | GXGL01 | KY394927 | KY393521 |
Primulina longii | XWB | JX506917 | JX506809 |
Primulina longzhouensis | P22963 | JX506918 | JX506810 |
Primulina lunglinensis | GZXY04 | KY394930 | KY393524 |
Primulina lunglinensis var. amblyosepala | LCDE | MK747105 | MK746281 |
Primulina lungzhouensis | GXJX10 | KY394931 | KY393525 |
Primulina luochengensis | LCWCGL01 | KY394932 | KY393526 |
Primulina lutea | 1844 | JX506921 | JX506813 |
Primulina lutescens | PBLS01 | MK747135 | MK746263 |
Primulina lutvittata | KFC4149 | MK369978 | MK369993 |
Primulina luzhaiensis | HYH019 | KC190197 | KC190204 |
Primulina mabaensis | SZY02 | KY394937 | KY393531 |
Primulina macrodonta | GXIB | JX506923 | JX506815 |
Primulina maculata | Xu11916 | KU220604 | KU220609 |
Primulina maguanensis | YNMG | MK747127 | MK746267 |
Primulina malipoensis | YNMLP01 | MK747123 | MK746240 |
Primulina medica | GXPLCM | KY394940 | KY393534 |
Primulina melanofilamenta | GXXA | MK747158 | MK746277 |
Primulina minor | WXXH1 | MK747160 | MK746290 |
Primulina minutimaculata | GXLZ10 | KY394941 | KY393535 |
Primulina moi | SGWY03 | KF498115 | KY393536 |
Primulina mollifolia | GXESWC | KY394943 | KY393537 |
Primulina multifida | DLXHGL01 | KY394946 | KY393540 |
Primulina nandanensis | GXJX02 | KY393541 | KY393541 |
Primulina napoensis | GXIB | JX506930 | JX506821 |
Primulina ningmingensis | NMGL01 | KY394949 | KY393543 |
Primulina obtusidentata | GZJK01 | KF498096 | KY393544 |
Primulina ophiopogoides | GXFS01 | KF498062 | KY393545 |
Primulina orthandra | ZRBC2 | MK747128 | MK746286 |
Primulina parvifolia | GGSL01 | KY394952 | KY393546 |
Primulina pengii | W0397 | KU220603 | KU220610 |
Primulina petrocosmeoides | SHDBC | KY394953 | KY393547 |
Primulina pinnatifida | MS02 | KY394954 | KY393548 |
Primulina polycephala | GDLZ06 | KY394955 | KY393549 |
Primulina porphyrea | DNGL01 | KU173793 | KU173799 |
Primulina pseudoeburnea | KY394958 | KY394958 | KY393552 |
Primulina pseudoglandulosa | GXYS06 | KF498138 | KY393482 |
Primulina pseudoheterotricha | XWB | JX506933 | JX506824 |
Primulina pseudolinearifolia | JXY | MK747140 | MK746280 |
Primulina pseudomollifolia | JMMXH1 | MK747134 | MK746244 |
Primulina pseudoroseoalba | JFHGL01 | KY394959 | KY393553 |
Primulina pteropoda | HNCJ01 | KY394960 | KY393554 |
Primulina pungentisepala | JEGL01 | KY394962 | KY393556 |
Primulina purpurea | ZHGL01 | KY394964 | KY393558 |
Primulina qingyuanensis | GDQX01 | KY394965 | KY394965 |
Primulina renifolia | GXDA02 | KY394966 | KY393560 |
Primulina repanda | GXBM03 | KY394968 | KY393562 |
Primulina ronganensis | GXRA01 | KF498135 | KY393564 |
Primulina rongshuiensis | GXRS01 | KF498088 | KY393565 |
Primulina roseoalba | LDGL01 | KY394972 | KY393566 |
Primulina rosulata | GXPL05 | KU528874 | KU528884 |
Primulina rotundifolia | OO3 | KY394975 | KY393569 |
Primulina rubribracteata | JH01R | KU173791 | KU173797 |
Primulina sclerophylla | GXDA01 | KY394979 | KY393573 |
Primulina secundiflora | GZQZ | MK747119 | MK746279 |
Primulina shouchengensis | GXYF02 | KY394980 | KY393574 |
Primulina sichuanensis | SCBC | MK747162 | MK746264 |
Primulina dryas | HKDMS | KY394875 | KY393469 |
Primulina sinovietnamica | Peng21956 | MK369973 | MK369988 |
Primulina spinulosa | GXFS02 | KF498063 | KY393576 |
Primulina subrhomboidea | GXYS02 | KY395018 | KY393577 |
Primulina subulata | GDYA01 | KY395020 | KY393579 |
Primulina subulata var. guilinensis | GXHYXH | KY394967 | KY393561 |
Primulina subulatisepala | CQAYH01 | MK747122 | MK746246 |
Primulina suichuanensis | GDLC07 | KY395021 | KY393580 |
Primulina swinglei | GXRX01 | KY395022 | KY393581 |
Primulina tabacum | LZ01 | KY395023 | KY393582 |
Primulina tenuifolia | GXBM01 | KY395024 | KY393583 |
Primulina tenuituba | GZGY01 | KY395025 | KY393584 |
Primulina tiandengensis | GXTD03 | KY395027 | KY393586 |
Primulina tribracteata | GXFS04 | KY395028 | KY393587 |
Primulina tribracteata var. zhuana | 1877 | JX506952 | JX506843 |
Primulina tsoongii | ZSGL01 | KY395029 | KY393588 |
Primulina varicolor | GXNP01 | KF498086 | KY393589 |
Primulina verecunda | LBJX01 | KY395031 | KY393590 |
Primulina versicolor | GDYD01 | MK747155 | MK746252 |
Primulina vestita | QZXT | MK747156 | MK746282 |
Primulina villosissima | QXY01 | KY395032 | KY393591 |
Primulina wenii | WENI | MK747148 | MK746284 |
Primulina wentsaii | GXLZ047 | KY395033 | KY393592 |
Primulina wuae | WSBC | MK747159 | MK746265 |
Primulina xinningensis | GGGL01 | KY394891 | KY393485 |
Primulina xiziae | ZJHZ01 | KY395038 | KY393597 |
Primulina yangchunensis | GDYC01 | KY395039 | KY393598 |
Primulina yangshanensis | GDNX01 | KY395040 | KY393599 |
Primulina yangshuoensis | GXYS07 | KY395042 | KY393601 |
Primulina yingdeensis | YD03 | KU528876 | KU528886 |
Primulina yungfuensis | GXIB | JX506957 | JX506848 |
Primulina zhoui | WF18 | MK747104 | MK746222 |
Primulina jiulianshanensis | WF217 | OP243287 | OP243283 |
We assembled and aligned the newly obtained sequences and those from GenBank using MAFFT v.7.017 (
The ITS matrix had a length of 782 characters, with 449 (57.4%) variable characters and 355 (45.4%) parsimony-informative. In comparison, the trnL-F matrix had a length of 836 characters, with 198 (23.6%) variable characters and 93 (11.1%) were parsimony-informative. The comparison of trees for ITS and trnL-F revealed no significant incongruence topology and both indicated that Primulina jiuyishanensis is closely related to P. wenii (Suppl. materials
Sequence differences of ITS and trnL-F regions between Primulina jiulianshanensis and P. wenii.
Species & marker | Sequences |
---|---|
P. jiulianshanensis ITS | 1~CCCGAGAACATGTTTAAAACACGCTTGCGT~30 |
P. wenii ITS | 1~CCCGAGAACATGTTTAAGACACGCTTGCGT~30 |
P. jiulianshanensis ITS | 141~CGAGCGCCTCTCCGTCCTGGCTAAGTTCGC~170 |
P. wenii ITS | 141~CGAGCGCCTCTCCGTACCGGTGAAGTTCGC~170 |
P. jiulianshanensis ITS | 396~CGTTTTTTCCACGCTCAAAAGGTGTC–GGGGACGA~430 |
P. wenii ITS | 396~CGTCTTTTCCACGCTCCAAAGGTGTCGGGGGAAGA~430 |
P. jiulianshanensis trnL-F | 501~GTTCAAAAGTCCTTTATCTT~520 |
P. wenii trnL-F | 501~GTTCAAAATTCCTTTATCTT~520 |
This new species differs from P. wenii by the combination of the following characteristics: petiole, both sides of leaf blades, adaxial surface of the calyx lobes, corolla inside toward the bottom, bract margins glandular-pubescent (vs. what above-mentioned eglandular-pubescent in P. wenii); lateral bracts 4–9 × ca. 2 mm, the central one 2–5 × 1–1.5 mm, adaxially glabrous but sparsely pubescent at apex (vs. lateral bracts 14–16 × 2.5–3.0 mm, the central one 10–12 × 1.3–1.6 mm, all adaxially pubescent); calyx lobes 8–11 × ca. 2 mm, each side with several brown serrate teeth at apex (vs. 14–15 × ca. 2.5 mm and entire); filaments and staminodes sparsely glandular-puberulent (vs. glabrous). Detailed morphological comparisons with P. wenii are provided in Table
Comparisons between the characters of Primulina jiulianshanensis and P. wenii.
Characters | Primulina jiulianshanensis | P. wenii |
---|---|---|
Petiole indumentum | densely villous and very sparsely glandular pubescent | densely villous |
Leaf blades indumentum | adaxially densely white to light red villous and very sparsely glandular pubescent, abaxially densely white villous and pubescent, and very sparsely glandular -pubescent | adaxially densely pubescent and villous, abaxially densely appressed pubescent |
Bract | lateral ones 4–9 × ca. 2 mm, the middle one 2–5 × 1–1.5 mm, all abaxially white or reddish pubescent, adaxially glabrous but sparsely pubescent at apex, margin ciliate and very sparsely glandular-puberulent | lateral ones 14–16 × 2.5–3.0 mm, the central one 10–12 × 1.3–1.6 mm; outside white pubescent and villous, adaxially white pubescent, margin entire and ciliate |
Calyx lobes | adaxially sparsely white puberulent and glandular puberulent, margin entire but each side of calyx lobes with 1–3 brown crenate teeth at apex; lobes 8–11 × ca. 2 mm | adaxially sparsely shortly pubescent to nearly glabrous, margin entire, lobes 14–15 × ca. 2.5 mm |
Filament | yellow from middle to base but white upper half, glandular-puberulent | white, glabrous |
Staminodes | yellowish, lateral ones very sparsely glandular-puberulent | white, glabrous |
China, Jiangxi Province: Ganzhou City, Longnan County, Jiulianshan National Nature Reserve, growing in shady and moist cliffs in the forest, 24°34'8.9"N, 114°25'49.7"E, altitude ca. 440 m, April 20, 2021, Guo-Liang Xu, JLSXGL-20210420 (Holotype IBK!; Isotype: KUN!)
Primulina jiulianshanensis sp. nov. A cyme B adaxial surfaces of bracts C abaxial surfaces of bracts D adaxial surfaces of calyx lobes E abaxial surfaces of calyx lobes F opened corolla G stamens and anthers H one of lateral staminodes I pistil J immature capsules K transverse section of capsule.
Herbs perennial, acaulescent, rhizome terete, 1–4 cm long, 0.8–1.5 cm in diam., leaves all basal, 4–8, petiole 10–40 × 4–13 mm, densely villous and very sparsely glandular-pubescent. Leaf blade oblong-elliptic or broadly elliptic, 4–13 × 4–8 cm, thickly chartaceous, more and less fleshly, adaxially pale green to dark green, densely white to light red villous and very sparsely glandular-pubescent, abaxially pale green, densely white villous and pubescent, and very sparsely glandular-pubescent, base apparently asymmetric but cuneate, margin irregularly obtuse-serrate, apex slightly obtuse, lateral veins 4–6 on each side, adaxially inconspicuously sunken, abaxially prominently raised. Inflorescence dichotomous cymes 2–4, axillary, 1–3-branched, 3–9-flowered or more; peduncle and pedicle green, erectly white or light red pubescent; peduncle 5–10 cm long, 2–3 mm in diam.; pedicle 5–15 mm long, 1–2 mm in diam. Bracts 3, lanceolate or spatulate, a pair on either side in same size, opposite, 4–9 mm long, ca. 2 mm wide, the middle one smaller, 2–5 mm long, 1–1.5 mm wide, all three abaxially white or reddish pubescent, adaxially glabrous but sparsely pubescent at apex, margin entire, ciliate and very sparsely glandular-puberulent, apex acute; bracteoles 3, shape and indumentum same as bracts, 2–5 mm long, 1–1.5 mm wide. Calyx 5-parted, lobes lanceolate, 8–11 mm long, ca. 2 mm wide, nearly equal, abaxially densely white or light red villous, adaxially sparsely white puberulent and glandular-puberulent, margin entire but each side of calyx lobes with 1–3 purplish brown crenate at the apex. Corolla pinkish purple to bluish purple, 3.6–4.0 cm long; corolla tube funnelform, 2.6–3 cm long, mouth 1.3–1.6 cm in diam., base ca. 5 mm in diam., outside densely glandular-pubescent, inside from the middle to the base sparsely glandular-puberulent, and the upper part of the corolla tube glabrous; corolla tube abdomen with two obviously longitudinal ridges, the upper part (close to the mouth) of the longitudinal ridge dark bluish purple, and the lower part (close to the bottom) changing into yellowish brown; a dark reddish-brown lump on the upper throat of the corolla tube inside and between upper lip lobes, ovate to spatulate, extending to the middle of the corolla tube, the lump densely glandular-puberulent; a narrow triangular thickened dark reddish-brown stripe extending to the middle of the corolla tube inside at each side of corolla tube and at the junction of the abaxial and adaxial lip; limb distinctly 2-lipped, adaxial lip 2-parted to the middle, lobes broadly ovate to semicircular, apex round, 6–8 mm long, 6–9 mm wide at the bottom; abaxial lip 3-parted to near the base, lobes elliptical to oblong, 8–12 mm long, 7–9 mm wide at the bottom. Stamens 2, adnate to 1.8 cm above the base of corolla tube; filaments linear, yellow from middle to base but white upper half, 8–11 mm long, geniculate near the base, glandular-puberulent; anthers reniform, slightly constricted at the middle, densely villous and fewer glandular-puberulent; staminodes 3, yellowish, lateral ones ca. 6 mm long, adnate to 14 mm above the base of corolla tube, straight, linear, very sparsely glandular-puberulent, apex capitate, the central one ca. 1 mm long, adnate to 5–6 mm above the base of corolla tube, glabrous. Disc annular, ca. 1 mm high, margin undulate, glabrous, white. Pistil pale green, 2.8–3.2 cm long; style linear, 1.9–2.3 cm long, ca. 1 mm in diam., upper part densely glandular-puberulent, lower part densely glandular-puberulent and eglandular-puberulent, ovary oblong, ca. 10 mm long, ca. 2 mm in diam., densely villous and glandular-pubescent, parietal placenta. Stigma acute triangle to narrowly obtrapeziform, 2-lobed, ca. 3 mm long. Capsule linear, 2–4 cm long, parietal placenta, densely villous and glandular-pubescent.
Flowering from April to May, fruiting from June to September.
The specific epithet ‘jiulianshanensis’ is derived from the type locality, Jiulianshan National Natural Reserve, Jiangxi Province, China.
九连山报春苣苔 (Chinese name); Jǐu Lían Shān Bào Chūn Jù Tái (Chinese pronunciation).
We found three small subpopulations in Jiulianshan National Nature Reserve in Jiangxi Province, which are distributed in the shady and wet place on the cliffs under the evergreen broad-leaved forest in the reserve. And the new species is mainly acccompanied by Begonia palmata D.Don, Utricularia striatula J.Smith, Selaginella moellendorffii Hieron., S. involvens (Sw.) Spring, etc.
At present, only three small subpopulations with total ca. 300 mature individuals of the new species are known in the type locality, Jiulianshan National Natural Reserve, Jiangxi Province, China. The three subpopulations are stable because they are in the reserve. The known AOO and EOO of the new species are about 0.2 km2 and 25 m2, respectively. Thus, if considering its fewer individuals of three subpopulations, it should be temporarily assessed as Near Threated (NT), following the IUCN Red List Categories and Criteria (
The mainly morphological differences are showed in diagnosis and Table
The type locality of Primulina wenii is Rixi Township, Fuzhou, Fujian Province, while the type locality of P. jiulianshanensis is Jiulian Mountain, Jiangxi Province. Their type localities are separated by the Wuyi Mountains, and the two places are more than 500 kilometers apart. P. wenii has a narrow distribution range and is only recorded in Rixi Township, Fuzhou, Fujian Province (
Except for a few species, such as Primulina fimbrisepala (Hand.-Mazz.) Yin Z.Wang, P. eburnea (Hance)Yin Z.Wang, P. tenuituba (W.T.Wang) Yin Z.Wang, P. juliae (Hance) Mich.Möller & A.Weber, most of the species of Primulina are narrowly distributed and endemic. Among the known species worldwide, more than 170 species are endemic to Karst areas in southern to southwestern China and to northern Vietnam (
We want to thank Stephen Maciejewski, the Gesneriad Society, and Michael LoFurno, Associate Professor, Temple University, Philadelphia, USA, for their editorial assistance. This study was financially supported by the Basic Research Fund of Guangxi Academy of Sciences (CQZ-C-1901), the Key Sci. & Tech. Research and Development Project of Guangxi (Guike AD20159091 & ZY21195050), the capacity-building project of SBR of CAS (KFJ-BRP-017-68), Basal Research Fund of GXIB (Guizhifa010) and the Fund of Technology Innovation Alliance of Flower Industry (2020hhlm005).
The tree of the trnL-F plastid marker for Primulina species
Data type: (phylogenetic, genomic, tree)
Explanation note: The trnL-F plastid marker and the ITS nuclear marker separately and discuss any incongruences between the two markers, particularly with respect to the position of the new species.
The tree of the ITS nuclear marker for Primulina species
Data type: (phylogenetic, genomic, tree)
Explanation note: The trnL-F plastid marker and the ITS nuclear marker separately and discuss any incongruences between the two markers, particularly with respect to the position of the new species.