Research Article
Print
Research Article
Mosla dadoensis (Lamiaceae), a new species from the southern islands of South Korea
expand article infoHyun-Do Jang‡, Kwi-Kwan Jeong§, Myoung-Ja Nam|, Jun-Ho Song, Hye-Kyoung Moon#, Hyeok Jae Choi¤
‡ Plant Resources Division, National Institute of Biological Resources, Incheon, Republic of Korea
§ Yeosu Post Office, Korea Post (Citizen Researcher), Yeosu, Republic of Korea
| The Society for Korean Peninsula Plants (Citizen Researcher), Anyang, Republic of Korea
¶ Herbal Medicine Resources Research Center, Korea Institute of Oriental Medicine, Naju, Republic of Korea
# Kyung Hee University, Seoul, Republic of Korea
¤ Changwon National University, Changwon, Republic of Korea

Corresponding author: Hyeok Jae Choi ( skinh@hanmail.net )

Academic editor: Eberhard Fischer
© 2022 Hyun-Do Jang, Kwi-Kwan Jeong, Myoung-Ja Nam, Jun-Ho Song, Hye-Kyoung Moon, Hyeok Jae Choi.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Jang H-D, Jeong K-K, Nam M-J, Song J-H, Moon H-K, Choi HJ (2022) Mosla dadoensis (Lamiaceae), a new species from the southern islands of South Korea. PhytoKeys 208: 185-199. https://doi.org/10.3897/phytokeys.208.89552
Open Access

Abstract

Mosla dadoensis (Lamiaceae), a new species from the southern islands of South Korea, is described and illustrated. The new species is morphologically similar to M. chinensis, but is distinguished from the latter by having two types of hairs on its stems, wider leaf blades, longer corolla length, and ellipsoid nutlets with a narrowly U-shaped extended area of abscission scar. Mosla dadoensis is also distinguished from the Chinese narrow endemic M. hangchouensis by having an included pistil to the corolla, smaller ellipsoid nutlets, and later flowering and fruiting season. Phylogenetic analyses, based on two nuclear ribosomal (ETS, ITS) and three chloroplast (rbcL, matK, trnL-F) DNA regions, confirmed that the new species was constructed as monophyletic, and that M. dadoensis and M. hangchouensis form a sister group with robust support. We hereby provide a detailed morphological description of M. dadoensis with its corresponding geographical distributions, and comparison tables of related taxa.

Keywords

Elsholtzieae, Korean endemic plant, morphology, phylogeny, taxonomy

Introduction

Mosla (Benth.) Buch.-Ham. ex Maxim. is a genus within the sixth largest family, Lamiaceae (the mint family). Although Mosla is a small genus of approximately 20 species, it is the second largest genus in the tribe Elsholtzieae (Wu and Li 1977a, b; Li and Hedge 1994; Harley et al. 2004). Elsholtzieae contains eight genera and roughly 70 species and is the smallest tribe within the most species-rich subfamily Nepetoideae (105 genera and about 3,400 spp.; Zhao et al. 2021). Mosla is mainly distributed in China, Japan, and Korea; however, M. dianthera (Buch.-Hamilt. ex Roxb.) Maxim. occurs in eastern Russia, the western Himalayas, and some Southeast Asian countries (Wu and Li 1977b; Li and Hedge 1994; Zhou et al. 1997; Govaerts et al. 2022). Phylogenetically, Mosla is nested within the eastern Asian Mosla-Keiskea-Perilla clade, and the monophyly of Mosla is strongly supported by previous morphological and taxonomic studies (Zhou 1995; Zhou et al. 1997; Li et al. 2017). Four fertile stamens are common in Elsholtzieae, and subequal or anterior pairs are normally longer, except in Mosla, which is characterized by two posterior fertile stamens (Harley et al. 2004; Kim 2018).

In Korea, four species of Mosla are recognized, namely M. chinensis Maxim., M. dianthera, M. japonica (Benth. ex Oliv.) Maxim., and M. scabra (Thunb.) C.W.Wu & H.W.Li (Seo and Park 2018; Korea National Arboretum 2020). The main diagnostic characteristics for species identification are the different leaf and calyx shapes. Leaves with a linear to linear-lanceolate shape are found only in M. chinensis and M. japonica, characterized by a subequal 5-toothed calyx. Although M. scabra and M. dianthera both have a 2-labiate calyx, the apex of the calyx lobe differs and is acute in M. scabra and obtuse in M. dianthera (Kim 2018).

During general floristic study in the southern part of Korea during October 2021, we found an unusual species which is restricted to the southern islands. This species is readily distinguished from previously known Mosla species in Korea by a considerably longer corolla. M. chinensis could be the closest ally, but the leaf shapes and flower features are significantly different. After a thorough literature survey and investigation of the relevant specimens, we designate M. dadoensis K.K.Jeong, M.J.Nam & H.J.Choi as a new species of Mosla from the southern islands of Korea. To clarify the systematic status of M. dadoensis we also conducted barcoding analysis based on nuclear ribosomal (nr) and chloroplast (cp) DNA regions, and observed detailed nutlet morphology, which is well known as a systematically important characteristic in Lamiaceae (Moon et al. 2009; Ryding 2010; Jeon et al. 2020). A detailed morphological description of M. dadoensis and its geographical distribution is also provided.

Materials and methods

Morphological characters

Morphological descriptions were based on specimens from the KB, KH (abbreviations are according to the Index Herbariorum [http://sweetgum.nybg.org/science/ih/]), and the herbarium of Changwon National University. Field surveys were also conducted from October 2021 to February 2022. Materials preserved in 70% ethanol were used for observation and measurement of floral parts. For quantitative characters, measurements were based on at least 50 samples.

Microscopic analysis

For morphological observations and size measurements, the nutlets were first examined using a stereomicroscope (SM; Olympus SZX16, Olympus, Tokyo, Japan). Nutlet sizes were measured using at least 30 randomly chosen individuals from each species. Prior to scanning electron microscopic observations, all the dried nutlets were rehydrated overnight using the wetting agent Agepon (Agfa-Gevaert, Leverkusen, Germany) and distilled water (1:200) at 37–40 °C. The rehydrated materials were dehydrated through an ethanol series (50%, 70%, 90%, 95%, and 100%) at room temperature for 1 h each. The completely dehydrated materials were immersed in liquid carbon dioxide (CO2) for critical point-drying (CPD; SPI-13200J-AB, SPI Supplies, West Chester, PA, USA). For the micromorphological observations, selected nutlets were mounted on aluminum stubs using a double-sided adhesive conductive carbon disk (05073-BA, SPI Supplies, West Chester, PA, USA). Specimens were coated with gold using an ion-sputtering device (208HR, Cressington Scientific Instruments Ltd., Watford, UK), and then observed using a low-voltage field emission scanning electron microscope (FE-SEM; JSM-7600F, JEOL, Tokyo, Japan) at an accelerating voltage of 10 kV and a working distance of 8–10 mm (Song and Hong 2020).

Phylogenetic analysis

To confirm the systematic placement of the putative new species within the genus Mosla, molecular phylogenetic analyses were conducted. The combined cpDNA dataset (rbcL, matK, and trnL-trnF) and nrDNA dataset (ITS, ETS) used in Li et al. (2017) were employed with the addition of three individuals (H.J.Choi 210923-001_1–3) of the putative new species (Table 1). Keiskea japonica Miq. was selected as the outgroup since it is a member of Elsholtzieae placed within the sister clade to Mosla (Li et al. 2017). Details of voucher information and GenBank accession numbers of the species used in this study are provided in Table 2.

Table 1.
Download as
CSV
XLSX

List of the primers used in phylogenetic analysis.

Fragment Primer Sequence 5' → 3’ Reference
ITS ITS1 TCCGTAGGTGAACCTGCGG White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC
ETS ETS-B ATAGAGCGCGTGAGTGGT Baldwin and Markos (1998)
18S-IGS GAGACAAGCATATGACTACTG Beardsley and Olmstead (2002)
rbcL rbcL_1F ATGTCACCACAAACAGAAAC Fay et al. (1998)
rbcL_724R TCGCATGTACCTGCAGTAGC
matK 3F_Kim_F CGTACAGTACTTTTGTGTTTA K.J.Kim, pers. comm.
1R_Kim_R ACCCAGTCCATCTGGAAATCT
trnL-F B49317 CGAAATCGGTAGACGCTACG Taberlet et al. (1991)
A50272 ATTTGAACTGGTGACACGAG

Total genomic DNA of M. dadoensis was extracted from silica gel-dried leaf materials using a DNeasy Plant Mini Kit (Qiagen Ltd., Crawley, West Sussex, UK). We conducted PCR with a ProFlex 96-Well PCR System (Applied Biosystems, Foster City, CA, USA). Each reaction mixture contained AccuPower PCR PreMix (Bioneer, Daejeon, South Korea), ca. 10 ng (1 μL) of genomic DNA, and 100 pM of primers in a total volume of 20 µL. Conditions included an initial denaturation at 95 °C for 5 min, followed by 40 amplification cycles comprising 95 °C for 30 sec, 50 °C for 30 sec, and 72 °C for 1 min, with a final extension at 72 °C for 5 min. After the PCR products were visualized on 2% agarose gels, they were treated with a MG PCR Purification kit (MGmed), and sequenced with the ABI 3730xl Analyzer, using the ABI BigDye Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems, Foster City, CA, USA).

Table 2.
Download as
CSV
XLSX

List of voucher information and GenBank accessions of species used in this study.

Species Voucher ETS ITS matK rbcL trnL-F
Mosla dadoensis 1 H.J.Choi_210923_001_1 ON619797 ON033689 ON619803 ON619806 ON619800
Mosla dadoensis 2 H.J.Choi_210923_001_2 ON619798 ON033690 ON619804 ON619807 ON619801
Mosla dadoensis 3 H.J.Choi_210923_001_3 ON619799 ON033691 ON619805 ON619808 ON619802
Mosla cavaleriei PNLI20120445 KY552608 KY552540 KY624903 KY624972 KY625040
Mosla chinensis PNLI20120245 KY552609 KY552541 KY624904 KY624973 KY625041
Mosla dianthera PNLI20120248 KY552610 KY552542 KY624905 KY624974 KY625042
Mosla hangchouensis PNLI20120424-1 KY552611 KY552543 KY624906 KY624975 KY625043
Mosla japonica PNLI20120416 KY552612 KY552544 KY624907 KY624976 KY625044
Mosla scabra PNLI20120427 KY552613 KY552545 KY624908 KY624977 KY625045
Mosla soochouensis PNLI20120414 KY552614 KY552546 KY624909 KY624978 KY625046
Mosla tamdaoensis C-K-393 KY552615 KY552547 KY624910 KY624979 KY625047
Keiskea japonica PNLI20120049-1 KY552605 KY552537 KY624901 KY624969 KY625037

Phylogenetic analyses were conducted using maximum likelihood (ML). The obtained sequences were aligned using MAFFT with Geneious Prime 2019.2.3 (Biomatters Ltd., Auckland, NZ). To assess the confidence of the phylogenetic relationships, a bootstrap test was conducted with 1,000 replications for the ML analysis. Kimura’s three-parameter model (Kimura 1980) was selected as the substitution model.

Results and discussion

Taxonomic treatment

Mosla dadoensis K.K.Jeong, M.J.Nam & H.J.Choi, sp. nov.

urn:lsid:ipni.org:names:77305495-1
Figs 1, 2, 3A, C, E, G, 4A, C, E

Diagnosis

This new species is morphologically similar to M. chinensis, but is easily distinguished from the latter by having two types of hairs on its stems, wider leaf blades, longer corolla length, and ellipsoid nutlets with a narrowly U-shaped extended area of abscission scar.

Figure 1. 

Mosla dadoensis A habit B raceme C stem D, E leaf (D adaxial E abaxial) F flower G, H corolla (S stamen P pistil) I calyx J seed. Photos from H.J.Choi 210923-001 (A–H) and H.J.Choi 211025-001 (I, J).

Type

Korea. Jeonnam: Yeosu-si, Geumo-do Isl., 34°30'11.1"N, 127°44'34.2"E, elev. 110 m, 22 Sep 2021 [fl], H.J.Choi 210923-001 [Holotype: KB (Fig. 2); Isotypes: CWNU, KB, KH, KIOM, KSM].

Figure 2. 

Photograph of the holotype of Mosla dadoensis.

Description

Herbs annual, aromatic. Stems 10–60 cm tall, many branched from base, densely pubescent with white recurved hairs and densely to moderately intermixed with white villous, with impressed glands. Leaves petiolate; petiole 2–5 mm long, pubescent with white villous; blades narrowly lanceolate to lance-ovate, 1–3 cm × 4–10 mm, sparsely pubescent, dotted with impressed glands, adaxially olive green, abaxially gray, base cuneate, margin remotely serrate, apex acute. Racemes terminal, 1–2.5 cm, bracts overlapping, circular-obovate, 5–7 × 4–5 mm, margin ciliate, apex caudate. Pedicel pubescent. Calyx campanulate, ca. 5 × 3 mm, dilated after anthesis, subequally 5-toothed; teeth subulate, ca. 2/3 to 3/4 as long as calyx tube. Corolla slightly 2-labiate, pale purple, ca. 1.5 times longer than bracts, 8–9 mm long, pubescent outside, pubescent with long white villous on lower lip inside; upper lip straight, emarginate; lower lip 3-lobed, middle lobe largest, slightly recurved. Stamens 4, included (non-exserted); filaments shorter than anthers; anthers linear, cells divergent, ca. 2 mm long, connectives distinct. Pistil included; sigma bifid. Nutlets brown to blackish-brown, ellipsoid, 1.2–1.6 × 0.9–1.3 mm, glabrous or sparsely pubescent with gland, pitted with deep depressions, abscission scar basal position, elliptic, extended, extended area narrowly U-shaped at the ventral side, ratio of abscission scar / nutlet diameter 0.51–0.53, primary sculpture outline of cells isodiametric, tetragonal to hexagonal, anticlinal walls straight, raised, thin, periclinal walls concave, secondary sculpture micropapillate.

Figure 3. 

Scanning electron microscope micrographs of nutlets in Mosla dadoensis (A, C, E, G) and M. chinensis (B, D, F, H) A, B abaxial C, D adaxial (C small picture showing gland) E, F primary sculpture pattern G, H secondary sculpture pattern (micropapillate).

Figure 4. 

Stereo- and scanning electron microscope micrographs of abscission scar in Mosla dadoensis (A, C, E) and M. chinensis (B, D, F).

Phenology

Flowering and fruiting from August to November.

Distribution and habitat

Endemic to southern coastal regions of Korea (Fig. 5). Open rocky area near the coast; at altitudes of 8–500 m.

Figure 5. 

Distribution map of Mosla dadoensis and M. chinensis in Korea.

Etymology

The specific epithet, “dadoensis”, is based on the name of location, the Dadohae southern coastal region of Korea, where Mosla dadoensis was discovered.

Vernacular name

The Korean name of the new species is “Da-do-hae-san-deul-kkae (다도해산들깨)”.

Morphological assessment

Mosla dadoensis is morphologically similar to M. chinensis, from which it is clearly differentiated by the hairs on its stems [white recurved hairs and intermixed with white villous (Fig. 1B) vs. white recurved hairs only], shape and size of leaf blades [narrowly lanceolate to lance-ovate, 1–3 cm × 4–10 mm (Figs 1D, E) vs. linear to linear-lanceolate, 1–5 cm × 1.3–4 mm], length of corolla [8–9 mm (Figs 1G, H) vs. 5–6 mm], and shape of nutlets [ellipsoid with narrowly U-shaped extended area of abscission scar (Figs 1J, 3A, C, 4A, C) vs. globose to subglobose with widely U-shaped extended area of abscission scar (Figs 3B, D, 4B, D)]. Mosla dadoensis is also distinguished from M. chinensis by its distinctive tetragonal to hexagonal nutlet surface cells with straight and thin anticlinal walls (Table 3; Fig. 3). In addition, this new species is morphologically similar to Chinese narrow endemic M. hangchouensis Matsuda. However, it is easily distinguished by its length of corolla [8–9 mm and ca. twice as long as calyx (Fig. 1F) vs. ca. 10 mm and ca. three times longer than calyx], relative length of pistil to the corolla [included (Figs 1B, F, G) vs. clearly exserted], shape and size of nutlets [ellipsoid, 0.9–1.3 mm in diam. (Figs 1J, 3A, C) vs. globose to subglobose, ca. 2.1 mm in diam], and later flowering and fruiting season (August to November vs. June to September). The major characters of the new species are compared to those of the related M. chinensis and M. hangchouensis in Table 3.

Table 3.
Download as
CSV
XLSX

Comparison of major characters of Mosla dadoensis, M. chinensis, and M. hangchouensis (*: data from Li and Hedge 1994; Zhou et al. 1997; Ge and Chang 2001).

Character M. dadoensis M. chinensis M. hangchouensis*
Habitat open rocky area along the coast grassy slope, forest edge, wet land sunny side of hill peak, forest edge, and under forest along the coast
Plant height (cm) 10–60 10–40 20–120
Stem trichome densely pubescent with white recurved hairs and moderately intermixed with white villous densely pubescent with white recurved hairs pubescent, brown glandular sometime intermixed with spreading pilose hairs
Leaf blade shape lanceolate to lance-ovate linear to linear-lanceolate lanceolate
size 1–3 cm × 4–10 mm 1–5 cm × 1.3–4 mm 1.5–4.2 cm × 5–13 mm
Corolla length (mm) 8–9 5–6 ca. 10
length ratio of corolla/calyx ca. 2.0 ca. 1.5 ca. 3.0
Pistil relative length to corolla included included clearly exserted
Nutlet shape ellipsoid globose to subglobose globose to subglobose
diameter (mm) 0.9–1.3 1.0–1.2 ca. 2.1
extended area of abscission scar narrowly U-shaped at the ventral side widely U-shaped at the ventral side widely U-shaped at the ventral side
ratio of abscission scar/nutlet diameter 0.51–0.53 0.61–0.69 NA
outline of surface cell tetragonal to hexagonal rounded tetragonal to hexagonal
anticlinal walls of surface straight, thin curved, thick straight, thin
Flowering and fruiting August to November June to October June to September

Phylogenetic analysis

The combined dataset has 12 aligned sequences comprising 2,910 bp (609 bp for ITS, 371 bp for ETS, 439 bp for rbcL, 736 bp for matK, and 755 bp for trnL-F), of which 102 occupied variable positions (3.51%). Our phylogenetic tree (Fig. 6) revealed a similar topology to that obtained in the previous study (Li et al. 2017). Mosla species were constructed as monophyletic, and M. dadoensis was classified as a clade independent from other members of Mosla on the ML tree. M. dadoensis was distinguished from M. chinensis, a related species distributed in China and Korea. Instead, the tree is shown to form a clade closer to M. dadoensis in Korea and M. hangchouensis in China (Fig. 6).

Figure 6. 

Phylogenetic tree of Mosla dadoensis and related taxa based on concatenated alignments of two nrDNA (ITS, ETS) and three cpDNA regions (rbcL, matK, trnL-F). The numbers above branches are bootstrap values (BS > 50%) used in the maximum likelihood method. Distribution information was obtained from Plants of the World Online (https://powo.science.kew.org).

Additional specimens examined

Mosla dadoensis (Paratypes): Korea: Jeonnam: Yeosu-si, Geumo-do Isl., 34°30'11.1"N, 127°44'34.2"E, elev. 110 m, 25 Oct 2021 (fr), H.J.Choi 211025-001 (CWNU); Goheung-gun (Naro-do Isl.), Bongrae-myeon, Jangpo-san, 34°25'25.46"N, 127°30'26.90"E, elev. 307 m, 26 Feb 2022, K.K.Jeong s.n. (CWNU); Goheung-gun (Naro-do Isl.), Bongrae-myeon, Bongrae-san, 34°25'45.51"N, 127°30'56.77"E, elev. 150 m, 26 Feb 2022, K.K.Jeong s.n. (CWNU); Jindo-gun, Yeogui-san, 34°23'41.91"N, 126°14'21.00"E, elev. 296 m, 27 Feb 2022, K.K.Jeong s.n. (CWNU); Jindo-gun, Imhoe-myeon, Namdong-ri, Hanbok-san, 34°22'18.1"N, 126°9'42.7"E, elev. 96 m, 9 Oct 2013 (fl, fr), JJP7102 (KB); Goheung-gun, Dohwa-myeon, 34°29'14.01"N, 127°19'26.06"E, elev. 8 m, 3 Mar 2022, K.K.Jeong s.n. (CWNU); Goheung-gun, Dohwa-myeon, 34°26'42.11"N, 127°20'06.30"E, elev. 39 m, 3 Mar 2022, K.K.Jeong s.n. (CWNU); Wando-gun, Bogil-myeon, Jeokja-bong, 3 Oct 2003 (fr), B.Y.Sun et al. s.n. (KB); Wando-gun, Bogil-myeon, Yesong-ri, Geokja-bong, 34°32'38.88"N, 126°55'39.32"E, elev. 303 m, 24 Oct 2013 (fr), kjs 130042 (KB); Wando-gun, Wando-eup, Daeya-ri, 34°22'12.22"N, 126°40'56.03"E, elev. 505 m, 11 Aug 2014, Y.H.Cho & H.J.Na 140811107 (KB); Wando-gun, Bogil-myeon, Buhwang-ri, 34.128717N, 126.535047E, elev. 50 m, 7 Oct 2017, WR-171007-075 (KH); Wando-gun, Bogil-myeon, Yesong-ri, Gyeokjabong, 34°08'15.50"N, 126°33'32.90"E, elev. 148 m, 7 Nov 2009 (fr), HNHM-2010-0355 (KH); Wando-gun, Cheongsan-myeon, Cheonggye-ri, 34.159905N, 126.897922E, elev. 80 m, 8 Sep 2017 (fl, fr), WR-170908-003 (KH); Wando-gun, Saengil-myeon, Bongseon-ri, 7 Sep 2003 (fl), Lee.Y.H. 030062 (KH). Gyeongnam: Namhae-gun (Namhae-do Isl.), Nam-myeon, Eungbong-san, 34°43'40.24"N, 127°53'15.65"E, elev. 268 m, 1 Mar 2022, K.K.Jeong s.n. (CWNU).

Mosla chinensis: Korea: Gyeonggi: Anyang-si, Dongan-gu, Bisan-dong, 37°25'23."N, 126°57'34.4"E, elev. 235 m, (fr), PWK-133 (KH); Suwon-si, Gwonseon-gu, Homaesil-dong, Chilbo-san, 37°15'40.39"N, 126°55'47.4"E, elev. 84 m, 24 Sep 2009 (fr), NIBRVP0000209769 (KB); Incheon-si, Ganghwa-gun, Gilsang-myeon, Donggeom-ri, Donggeom-do Isl., 37°35'25.2"N, 126°31'2.7"E, elev. 63 m, 8 Sep 2012, NIBRVP0000400499 (KB); Paju-si, Tanhyeon-myeon, Bupheung-ri, 37°46'02.4"N, 126°41'19.4"E, elev. 100 m, 30 Aug 2006, VP-NAPI-376034-053 (KB). Chungbuk: Jeungpyeong-gun, Jeungpyeong-eup, Jwagu-san, 36°42'41.8"N, 127°39'39.2"E, elev. 500 m, 25 Aug 2011 (fl), Geumbuk-203 (KH). Chungnam: Seosan-si, Daesan-eup, Ungdo-ri, 36°55'04.4"N, 126°22'24.8"E, elev. 0 m, 15 Aug 2012, DJUIDC20120154 (KH). Jeonbuk: Gimje-si, Dojang-dong, Hwang-san, 35°46'35"N, 126°56'30.1"E, elev. 12 m, 27 Aug 2011, 357014-0420 (KB). Jeonnam: Haenam-gun, Hwangsan-myeon, Wonho-ri, Hakdong village, 34°34'15.14"N, 126°29'2.22"E, elev. 3 m, 17 Sep 2008 (fl), ParkSH81875 (KH); Jindo-gun, Jodo-myeon, Sinyuk-ri, Hajo-do Isl., Sinjeon beach, 34°17'21.5"N, 126°01'88.1"E, elev. 39 m, 6 Sep 2011, HS110899 (KH); Sinan-gun, Docho-myeon, Oryu-ri, Near Simok Sandbeach, 34.725447N, 125.908671E, elev. 30 m, 24 Oct 2007, WR-071024-170 (KH); Sinan-gun, Docho-myeon, Oryu-ri, Near Simok Sandbeach, 34.725447N, 125.908671E, elev. 30 m, 24 Oct 2007, NAM-071024-199 (KH); Yeonggwang-gun, Hongnong-eup, Gyema-ri, Gamami beach, 11 Sep 2012, P126974 (KH); Hwasun-gun, Doam-myeon, Daecho-ri, Cheonbulsan, Unjusa, 34°55'27.3"N, 126°52'14.0"E, elev. 109 m, 6 Sep 2009, SGU 0940 (KH); Gangjin-gun, Byeongyeong-myeon, Jiro-ri, Suin-san, 34°42'56.9'N, 126°50'18.5"E, elev. 174 m, 12 Aug 2014 (fl), HNHM-D-140197 (KH); Sinan-gun, Aphae-myeon, Songgong-ri, Songgong-san wetland, 34.844604N, 126.252203E, elev. 25 m, 19 Sep 2007 (fl), WR-070919-255 (KH); Jindo-gun, Gunnae-myeon, Geumseong-ri, 34°32'54.1"N, 126°17'38.6"E, elev. 30 m, 14 Sep 2005 (fr), ESJeon 52851 (KH); Naju-si, Dado-myeon, Masan-ri, Bulhoe-sa Temple, 34°55'15.7"N, 126°53'35.8"E, elev. 126 m, 14 Sep 2005, ESJeon 52829 (KH); Hampyeong-gun, Hakgyo-myeon, Gokchang-ri, 35.026751°N, 126.570272°E, elev. 100 m, 9 Sep 2012 (fl), WR-20120909-044 (KH); Sinan-gun, Amtae-myeon, Songgok-ri, Amtae-do Isl., 34°50'20.5"N, 126°8'35.9"E, elev. 13 m, 10 Oct 2019, YLJLVP0000006165 (KB); Gangjin-gun, Gundong-myeon, Pungdong-ri, Seongjak-gol, 34°30'48.45"N, 126°40'49.90"E, elev. 294 m, 23 Sep 2010, C201009-0117 (KB); Sinan-gun, Aphae-myeon, Janggam-ri, 34°49'3.9"N, 126°20'58.1"E, elev. 14 m, 4 Oct 2012 (fl), KOSPVP0000256241 (KB); Jindo-gun, Gunnae-myeon, Dunjeon-ri, Geumgol-san, 34°32'24.8"N, 126°17'39.2"E, elev. 81 m, 27 Oct 2013 (fl), KOSPVP0000291190 (KB); Sinan-gun, Jeungdo-myeon, Jeungdong-ri, Gubunpo, Gwakdae-bong to Bunpo reservoir, 28 Sep 1997 (fl), EN97CUB404 (KB). Gyeongbuk: Sangju-si, Jungdong-myeon, Hoesang-ri, Hwanggeum-san, 36°27'55.3"N, 128°16'34.2"E°, elev. 210 m, 9 Sep 2012 (fl), KTPSA-2012076 (KH); Daegu-si, Dong-gu, Jimyo-dong, 35°56'25.09"N, 128°39'49.04"E, elev. 202 m, 21 Aug 2013 (fl), DJUIDC2013-212 (KH); Yecheon-gun, Jibo-myeon, Amcheon-ri, 36°33'06.00"N, 128°27'11.09"E, elev. 11 m, 7 Sep 2011 (fl), Nakdong-1632 (KH); Gyeongbuk, Sangju-si, Jungdong-myeon, Hoesang-ri, 36°27'54.9"N, 128°16'37.0"E, elev. 236 m, 8 Sep 2012, NAPI2012-0153 (KH); Cheongsong-gun, Hyeonseo-myeon, Hwamok-ri, 36°16'24.4"N, 128°52'22.1"E, elev. 387 m, 3 Aug 2018, NIBRVP0000703391 (KB); Gunwi-gun, Bugye-myeon, Changpyeong-ri, San 100, 36°4'56.36"N, 128°41'34.59"E, elev. 225 m, 27 Sep 2019 (fr), NIBRVP0000756907 (KB); Andong-si, Iljik-myeon, Wonho-ri, Jaam-san, 36°29'54.08"N, 128°40'37.14"E, elev. 302 m, 21 Aug 2017 (fl), NIBRVP0000632258 (KB); Gunwi-gun, Bugye-myeon, Changpyeong-ri, 36°4'59.04"N, 128°41'35.97"E, elev. 220m, 29 Aug 2019, NIBRVP0000754852 (KB); Uiseong-gun, Bian-myeon, Jarak-ri, Haemang-san, 36°22'52.31"N, 128°31'3.79"E, elev. 202 m, 3 Oct 2017 (fr), NIBRVP0000643724 (KB); Gimcheon-si, Nam-myeon, Busang-ri, Geumo-san, San 168-7, 36°3'58.8"N, 128°16'34.1"E, elev. 220 m, 20 Sep 2015 (fl), NIBRVP0000585241 (KB); Gumi-si, Namtong-dong, Geumo-san, Peak to Beopseong temple, 36°5'52.5"N, 128°19'46"E, elev. 250 m, 5 Oct 2015 (fr), NIBRVP0000586707 (KB). Gyeongnam: Milyang-si, Muan-myeon, Garye-ri, Yeongchwi-san, 35°29'57.40"N, 128°35'02.20"E, elev. 201 m, 14 Sep 2009 (fr), HNHM-2009-0392 (KH).

Acknowledgements

This research was funded by the National Institute of Biological Resources, Ministry of Environment of South Korea (Grant Number NIBR202208101).

References

  • Baldwin BG, Markos S (1998) Phylogenetic utility of the external transcribed spacer (ETS) of 18S-26S rDNA: Congruence of ETS and ITS trees of Calycadenia (Compositae). Molecular Phylogenetics and Evolution 10(3): 449–463. https://doi.org/10.1006/mpev.1998.0545
  • Beardsley PM, Olmstead RG (2002) Redefining Phrymaceae: The placement of Mimulus, tribe Mimuleae, and Phryma. American Journal of Botany 89(7): 1093–1102. https://doi.org/10.3732/ajb.89.7.1093
  • Fay MF, Bayer C, Alverson WS, de Bruijn AY, Chase MW (1998) Plastid rbcL sequence data indicate a close affinity between Diegodendron and Bixa. Taxon 47(1): 43–50. https://doi.org/10.2307/1224017
  • Govaerts R, Dransfield J, Zona S, Hodel DR, Henderson A (2022) World Checklist of Lamiaceae. Facilitated by the Royal Botanic Gardens, Kew. [Published on the Internet.] http://wcsp.science.kew.org/
  • Harley RM, Atkins S, Budantsev A, Cantino PD, Conn BJ, Grayer R, Harley M (2004) Labiatae. In: Kubitzki K, Kadereit JW (Eds) The Families and Genera of Vascular Plants, vol. 7. Springer, Berlin & Heidelberg, 167–275. https://doi.org/10.1007/978-3-642-18617-2_11
  • Jeon YC, Jang TS, Hong SP (2020) Nutlet morphology in the tribe Elsholtzieae (Lamiaceae). Nordic Journal of Botany 38(8): e02677. https://doi.org/10.1111/njb.02677
  • Kim ST (2018) Mosla. In: Flora of Korea Editorial Committee (Eds) Flora of Korea, vol. 6a. National Institute of Biological Resources, Incheon, 118–120.
  • Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16(2): 111–120. https://doi.org/10.1007/BF01731581
  • Korea National Arboretum (2020) Checklist of Vascular Plants in Korea (Native Plants). Korea National Arboretum, Pocheon, 1006 pp.
  • Li HW, Hedge IC (1994) Lamiaceae. In: Wu CY, Raven PH (Eds) Flora of China, vol. 17. Science Press, Beijing & Missouri Botanical Garden Press, St. Louis, 50–299.
  • Li P, Qi ZC, Liu L, Ohi-Toma T, Lee J, Hsieh TH, Fu CX, Cameron KM, Qiu YX (2017) Molecular phylogenetics and biogeography of the mint tribe Elsholtzieae (Nepetoideae, Lamiaceae), with an emphasis on its diversification in East Asia. Scientific Reports 7(1): e2057. https://doi.org/10.1038/s41598-017-02157-6
  • Moon HK, Hong SP, Smets E, Huysmans S (2009) Micromorphology and character evolution of nutlets in tribe Mentheae (Nepetoideae, Lamiaceae). Systematic Botany 34(4): 760–776. https://doi.org/10.1600/036364409790139592
  • Seo YB, Park CW (2018) Mosla. In: Flora of Korea Editorial Committee (Eds) The Genera of Vascular Plants of Korea. Hongrung Publishing Co., Seoul, 1110–1112.
  • Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17(5): 1105–1109. https://doi.org/10.1007/BF00037152
  • White TJ, Bruns TD, Lee SB, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR protocols: a guide to methods and applications. Academic Press, San Diego, California, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • Wu CY, Li HW (1977a) Flora Reipublicae Popularis Sinicae, vol. 65(2). Labiatae (1). Science Press, Beijing, 649 pp.
  • Wu CY, Li HW (1977b) Flora Reipublicae Popularis Sinicae, vol. 66. Labiatae (2). Science Press, Beijing, 647 pp.
  • Zhao F, Chen YP, Salmaki Y, Drew BT, Wilson TC, Scheen AC, Celep F, Bräuchler C, Bendiksby M, Wang Q, Min DZ, Peng H, Olmstead RG, Li B, Xiang CL (2021) An updated tribal classification of Lamiaceae based on plastome phylogenomics. BMC Biology 19(1): 2. https://doi.org/10.1186/s12915-020-00931-z
  • Zhou SL (1995) Systematics and evolution of the genus Mosla (Labiatae). Ph.D. dissertation. Institute of Botany, Chinese Academy of Sciences, Beijing, China. [In Chinese]
login to comment