Research Article
Print
Research Article
Sinosenecio yangii (Asteraceae), a new species from Guizhou, China
expand article infoJing-Yi Peng‡, Dai-Gui Zhang‡, Tao Deng§, Xian-Han Huang§, Jun-Tong Chen§, Ying Meng‡, Yi Wang‡, Qiang Zhou‡
‡ Jishou University, Jishou, China
§ CAS Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, China

Corresponding author: Qiang Zhou ( zhouqiang@jsu.edu.cn )

Academic editor: Alexander Sennikov
© 2022 Jing-Yi Peng, Dai-Gui Zhang, Tao Deng, Xian-Han Huang, Jun-Tong Chen, Ying Meng, Yi Wang, Qiang Zhou.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Peng J-Y, Zhang D-G, Deng T, Huang X-H, Chen J-T, Meng Y, Wang Y, Zhou Q (2022) Sinosenecio yangii (Asteraceae), a new species from Guizhou, China. PhytoKeys 210: 1-13. https://doi.org/10.3897/phytokeys.210.89480
Open Access

Abstract

A new species Sinosenecio yangii D.G. Zhang & Q. Zhou (Asteraceae, Senecioneae) from Guizhou Province, China, is described and illustrated based on its morphological characteristics and molecular evidence. It closely resembles S. confervifer and S. guangxiensis, the former in the scapigerous habit and smooth and glabrous achene surface, the latter in the calyculate involucre and purple abaxial leaf surface, and both in the shape and indumentum of leaf lamina, but differs markedly from the latter two in having fewer capitula and epappose achenes. Phylogenetic analysis based on nrITS and ndhC-trnV sequences shows that this new species belongs to the S. latouchei clade and is sister to S. guangxiensis with moderate support.

Keywords

molecular evidence, morphology, pappus

Introduction

Sinosenecio B. Nordenstam (1978) (Senecioneae, Asteraceae) contains 45 species mainly distributed in central and southwestern parts of China (Chen et al. 2011; Liu and Yang 2012; Liu et al. 2019; Zou et al. 2020; Chen et al. 2022). This genus is characterized by subscapiform or leafy stems, palmately or rarely pinnately veined leaf lamina, solitary to numerous capitula, and ecalyculate or sometimes calyculate involucres, etc. (Jeffrey and Chen 1984). Sinosenecio encompasses two species assemblages, i.e. the Sinosenecio s.s. group and the S. oldhamianus group, with different chromosome number (x = 30 vs. 24 or 13), patterns of endothecial cell wall thickenings (strictly polarized vs. polarized and radial), and phylogenetic affiliation (subtrib. Tussilagininae s.s. vs. subtrib. Thephroseridinae) (Liu 2010; Liu and Yang 2011a, b; Gong et al. 2016). These two groups also differ in geographical distribution. The former is restricted to mountainous regions around Sichuan Basin, southwestern China, and the latter is widely distributed in central and southern China, with two species extending to Indochina (Gong et al. 2016). However, a formal taxonomic adjustment is not yet proposed as phylogenetic relationships in subtrib. Thephroseridinae need to be further clarified (Nordenstam and Pelser 2011).

Libo County (Guizhou Province, China) belongs to the slope zone of transition from Guizhou Plateau to Guangxi Hilly Basin with typical karst topography and complex and diverse ecological environment (Tan 2010). In the past few years, some new species have been reported in this area, such as Strobilanthes hongii (Chen et al. 2019) and Petrocodon luteoflorus (Fan et al. 2020). During our field investigation at Lihua Town, Libo County in March 2021, we found several unusual Sinosenecio populations that morphologically resemble two members of the S. oldhamianus group, namely S. confervifer (H. Léveillé) Y. Liu & Q. E. Yang and S. guangxiensis C. Jeffrey & Y. L. Chen, but differs markedly from them in several morphological features, respectively. After examining herbarium specimens and relevant literature, we verified that it represents an undescribed species. Here, we described it as S. yangii D. G. Zhang & Q. Zhou with report on its chromosome number and phylogenetic position.

Materials and methods

Morphological observation

Morphological examination and comparison of the new species with S. confervifer and S. guangxiensis were based on fresh materials and herbarium specimens. Chromosome observation was conducted according to Meng et al. (2010).

Molecular analyses

To test the phylogenetic affiliation of S. yangii, we carried out phylogenetic analysis based on combined matrix of ITS and ndhC-trnV sequences. The matrix contained 23 accessions from 20 species, including the new species, 16 species of S. oldhamianus group, two of Nemosenecio, and an outgroup Tephroseris flammea (Turcz. ex DC.) Holub. The ITS and ndhC-trnV of S. yangii were sequenced in this study and the rest were downloaded from GenBank. The GenBank accession numbers are listed in Appendix 1. Total DNA was extracted from dried leaves using Plant Genomic DNA Kit DP305 (Beijing, China) and used as the template for polymerase chain reaction (PCR). The primers used in this study are listed in Table 1. Sequences obtained were edited using Sequencher-5.4.5 and then combined by Sequence Matrix-1.9 (Vaidya et al. 2011). Multi-sequence alignment and manual adjustment were conducted using programme CLUSTAL_W in Mega-X64 (Rédei 2008) and gaps were treated as missing data.

Table 1.
Download as
CSV
XLSX

Primers used in this study.

Region Name Primer sequence (5´–3´)
nrITS ITS1 AGAAGTCGTAACAAGGTTTCCGTAGG
ITS4 TCCTCCGCTTATTGATATGC
ndhC-trnV ndhCretF AAGTTTCTCCGGTCCTTTGC
trnVretR TCTACGGTTCGAGTCCGTATAG

Phylogenetic trees were constructed using Bayesian Inference (BI) and Maximum Likelihood (ML) in CIPRES Portal (https://www.phylo.org/portal2). BI and ML analyses were performed using MrBayes version-3.2 (Ronquist et al. 2012) and RAxML-8.2.10 (Stamatakis 2014), respectively. For BI analysis, GTR+G was selected as best-fitting model using Akaike information criterion (AIC) in JmodelTest 2-2.1.6 (Posada 2008). The Markov chain Monte Carlo analyses were run with four simultaneous chains of 10,000,000 generations sampling one tree every 1,000 generations. After the first 25% of trees were discarded as burn-in, the remaining trees were used to construct a majority-rule consensus tree with Bayesian posterior probabilities. ML analysis was performed with GTRCAT model, support values was calculated with 1,000 bootstrap replicates using a fast bootstrapping algorithm (Stamatakis et al. 2008).

Results

Morphology and taxonomy

Morphological observation (Fig. 1) showed that S. yangii, S. confervifer, and S. guangxiensis share obvious resemblance in the leaf blade shallowly undulate and suborbicular, adaxially densely to sparsely villous and abaxially sparsely pubescent or nearly glabrous (Table 2). In addition, S. yangii is similar to S. confervifer in the stem leafless or with 1–2 bract-like leaf and smooth achene surface, and to S. guangxiensis in the calyculate involucre. Nevertheless, S. yangii differs from both species in having fewer capitula (usually 1–3) and epappose achenes. The metaphase chromosomes of this species were counted to be 2n = 48 (Fig. 2A). The achene surface was glabrous and smooth (Fig. 2B) and the anther endothecial cell wall thickenings were polarized and radial (Fig. 2C).

Table 2.
Download as
CSV
XLSX

Comparison of morphological characteristics among Sinosenecio yangii, S. guangxiensis and S. confervifer.

S. yangii S. guangxiensis S. confervifer
Height (cm) 15–25 10–30 10–65
Leaf shape Suborbicular or reniform, margin irregularly deltoid or rounded dentate, shallowly undulate or nearly entire Suborbicular or reniform, margin coarsely repand or dentate with ovate-deltoid teeth Orbicular or suborbicular, margin repand or lobed, with rounded or broadly deltoid mucronulate or obscurely mucronulate shallow teeth or lobes
Leaf size (cm) 2.5–4.5 × 2.5–6.5 2–6 × 2.5–7 1.5–6 × 2–6
Adaxial surface of leaf lamina Green, densely or sparsely pubescent Green or dark green, sparsely todensely villous or glabrous Lustrous, green or deep green, densely or sparsely villous or glabrous
Abaxial surface of leaf lamina Pale green or purplish red, sparsely arachnoid or nearly glabrous Deep purplish red, densely white tomentose, sparsely villous or glabrescent Pale green or slightly purple with sparsely arachnoid, veins villous or pubescent
Cauline leaves 1–2, bract-like 1–5, similar to radical ones 1–2, bract-like
Petiole base of cauline leaves Expanded, not auriculate Slightly expanded, not auriculate Expanded, not auriculate
Number of capitula Usually1, sometimes 2 or 3 2–7 or more, rarely 1 1–7 (–10) or more
Involucre Calyculate Calyculate Not calyculate
Phyllaries 13 13 13
Chromosome number 2x 48 48 48
Achene surface Smooth, glabrous Papillate, pubescent Smooth, glabrous
Pappus Absent Present Present
Geographical distribution Guizhou Guangxi, southwestern Hunan Hunan, Sichuan, Chongqing, Guizhou, Yunnan
Figure 1. 

Sinosenecio yangii A habitat B habit C–E leaves F capitulum G bottom and side of involucres (from left to right) H ray floret, disc floret and phyllary (from top to bottom).

Figure 2. 

Sinosenecio yangii A metaphase chromosomes (2x = 48) B smooth and glabrous achene surface C polarized and radial endothecial cell wall thickenings.

Phylogenetic analyses

The combined matrix of ITS and ndhC-trnV sequences contained 1,324 aligned bp. Bayesian (BI) and Maximum likelihood (ML) trees had similar topologies. The BI tree was presented in Fig. 3 with BI posterior probability (BP) and ML bootstrap support values (LP) labelled on the branches. Ingroups were resolved into two clades, viz. the S. latouchei clade (BP = 1, LP = 99) and the S. oldhamianus-Nemosenecio clade (BP = 1, LP = 99). Sinosenecio yangii was resolved as sister to S. guangxiensis (BP = 0.87, LP = 71) in the former clade, while S. confervifer was recovered as a member in the latter clade.

Figure 3. 

Bayesian phylogenetic tree based on the combined data of ITS and ndhC-trnV sequences. Numbers above and below branches are Bayesian posterior probabilities and ML bootstrap values, respectively. A and B represent the S. latouchei clade and S. oldhamianus-Nemosenecio clade. Sinosenecio yangii is noted in bold.

Discussion

Several lines of evidence demonstrated that S. yangii is a member of the S. oldhamianus group. Sinosenecio yangii has a base chromosome number of x = 24 (Fig. 2A) and polarized and radial anther endothecial cell wall thickenings (Fig. 2C), which are typical of the S. oldhaminanus group. Analyses of ITS and ndhC-trnV sequences also corroborated its phylogenetic affiliation, resolving it as sister to S. guangxiensis in the S. latouchei clade of S. oldhaminanus group.

Sinosenecio yangii was morphologically and phylogenetically close to S. guangxiensis in the S. latouchei clade. However, there are differences in morphology, distribution and ecology between the two species. S. yangii is easily distinguished from S. guangxiensis in the stem leafless or with 1–2 bract-like leaf (vs. 1–5 cauline leaves), fewer capitula (vs. 2–7 or more), smooth and glabrous achene surface (vs. papillate and pubescent), and epappose achenes (vs. present pappus). From the perspective of distribution area, the former is restricted to Libo County in Guizhou, appearing on the wet rock cliff, and the geographical location is adjacent to the border with Guangxi province. The latter is distributed in the Guangxi and southwestern Hunan, growing on the damp, shady places or rocky places at mountain summits. To some extent, the close relationship between these two species may also be related to their distributional ranges adjacent to each other. Additionally, it is worth noting that the epappose achenes of S. yangii is a character previously never recorded in the S. latouchei clade.

Taxonomic treatment

Sinosenecio yangii D. G. Zhang & Q. Zhou, sp. nov.

urn:lsid:ipni.org:names:77305747-1
Figs 4, 5

Type

China. Guizhou: Libo County, Lihua Town, 25°36'53"N, 108°12'63"E, on rock cliff by the side of a rural road, elev. 347 m, 16 March 2021, D. G. Zhang & T. Deng 14231. (holotype: JIU! ; isotype: JIU!).

Description

Scapigerous herbs. Rhizomes short and stout with many fibrous roots. Stems slender, scapiform, erect or declining, solitary or several, 13–22 cm long, basally reddish-brown and sparsely white villous, almost smooth in upper part. Radical leaves several; petiole ca. 3–6.5 cm long, densely villous or glabrescent, basally expanded, not auriculate; lamina suborbicular or reniform, ca. 2.5–4.5 × 2.5–6.5 cm, base cordate, margin irregularly triangular dentate, shallowly undulate or entire, apex slightly acute; adaxially green, densely or sparsely pubescent, abaxially pale green or purplish red, sparsely arachnoid or nearly glabrous. Upper leaves 1 or 2, bract-like, shortly petiolate, lanceolate. Capitula usually 1–3, peduncles slender, ca. 2–3.5 cm long, with a basal linear bracteole, or with 1–2 small linear bracteoles in the upper part. Involucres campanulate, calyculate with 2–3 bracteoles or more; phyllaries ca. 13, lanceolate, ca. 6 mm long, with ciliate margin, apically acute or obtuse and sometimes purplish. Ray florets ca. 13, corolla tube 3 mm long, glabrous; ray yellow, oblong, ca. 12 mm long, 4-veined, apically 3-denticulate. Disc florets numerous; corolla yellow, 4 mm, with ca. 1.5 mm glabrous tube and 0.85 mm limb. Anthers oblong, 5, ca. 1.2 mm long, basally obtuse. Style branches ca. 0.5 mm long, puberulent. Achenes ca. 1 mm long, smooth and glabrous. Pappus absent.

Figure 4. 

Holotype sheet of Sinosenecio yangii D. G. Zhang & Q. Zhou.

Figure 5. 

Sinosenecio yangii A habit B capitulum C ray floret D disk floret E phyllary F stamens G style (drawing by Chu-miao Xie).

Phenology

Flowering from March to May, fruiting from April to June.

Etymology

The species was named after Professor Qin-er Yang, an expert in the field of Asteraceae at the Chinese Academy of Sciences. The Chinese name is given as “亲二蒲儿根” (qīn èr pú ér gēn).

Distribution and habitat

Sinosenecio yangii is known from Lihua Town, Libo County, Guizhou Province, China (Fig. 6). It was collected from a rock cliff by the side of a rural road in this town, at an altitude of 347 m.

Figure 6. 

Distribution of Sinosenecio yangii.

Key to species of the S. latouchei clade

1 Pappus absent S. yangii
– Pappus present. 2
2 Leaf lamina peltate S. peltatus
– Leaf lamina not peltate 3
3 Involucres calyculate 4
– Involucres ecalyculate. 5
4 Cauline leaf absent or 1 and bract-like; base of petiole of cauline leaf slightly auriculate; capitula solitary, rarely 2 or 3 S. jiangxiensis
– Cauline leaves 1–5, similar to radical ones; base of petiole of cauline leaves never auriculate; capitula 1–5 or more S. guangxiensis
5 Ovaries and achenes glabrous 6
– Ovaries and achenes pubescent. 7
6 Leaf lamina broadly flabellate or suborbicular, dentate or palmately lobed to 1/2, lobes apically 2 or 3-denticulate, both surfaces glabrous S. wuyiensis
– Leaf lamina reniform or suborbicular, regularly 5–7-palmatilobed, lobes ovate-triangular, both surfaces glabrous or sometimes white tomentose abaxially and later glabrescent S. saxatilis
– Leaf lamina ovate, broadly ovate, rarely ovate-orbicular, inconspicuously undulate-dentate, adaxial surface villous, sometimes sparsely arachnoid, and abaxial surface villous and densely white arachnoid S. ovatifolius
7 Stem erect or flexuous; cauline leaves 1–3; leaf lamina adaxially villous with spreading hairs; leaf auricles 4–10 mm in diameter S. latouchei
– Stem erect; cauline leaves 3–7; leaf lamina adaxially pubescent with appressed hairs or sparsely or densely white tomentose; leaf auricles 7–30 mm in diameter S. jiuhuashanicus

Acknowledgements

We thank Chu-miao Xie and Xin-yuan Kuai for preparing the line drawing and illustration. We are very grateful to Wen-guang Sun (Yunnan Normal University) for his help in the experimental part of the manuscript. This work was supported by the Ecological Adaptability of Four Narrow Endemic Sinosenecio Species in Wuling Mountain Region (31860117), National Natural Science Foundation of China.

References

  • Chen YL, Liu Y, Yang QE, Nordenstam B, Jeffrey C (2011) Sinosenecio B. Nord. In: Wu ZY, Raven PH (Eds) Flora of China (vol. 20–21). Science Press and Missouri Botanical Garden Press, 464–48.
  • Gong W, Liu Y, Chen J, Hong Y, Kong HH (2016) DNA barcodes identify Chinese medicinal plants and detect geographical patterns of Sinosenecio (Asteraceae). Journal of Systematics and Evolution 54(1): 83–91. https://doi.org/10.1111/jse.12166
  • Jeffrey C, Chen YL (1984) Taxonomic studies on the tribe Senecioneae (Compositae) of Eastern Asia. Kew Bulletin 39(2): 205–446. https://doi.org/10.2307/4110124
  • Liu Y (2010) A systematic study of the genus Sinosenecio B. Nord. (Compositae). PhD Thesis, Institute of Botany, Chinese Academy of Sciences, Beijing.
  • Liu Y, Yang QE (2011a) Floral micromorphology and its systematic implications in the genus Sinosenecio (Senecioneae-Asteraceae). Plant Systematics and Evolution 291(3–4): 243–256. https://doi.org/10.1007/s00606-010-0385-z
  • Liu Y, Yang QE (2011b) Hainanecio, a new genus of the Senecioneae, Asteraceae from China. Botanical Studies (Taipei, Taiwan) 52: 115–120.
  • Liu Y, Yang QE (2012) Sinosenecio jiangxiensis (Asteraceae), a new species from Jiangxi, China. Botanical Studies (Taipei, Taiwan) 53: 401–414.
  • Meng Y, Sun H, Yang YP, Nie ZL (2010) Polyploidy and new chromosome counts in Anaphalis (Asteraceae: Gnaphalieae) from the Qinghai-Tibet Plateau of China. Journal of Systematics and Evolution 48(1): 58–64. https://doi.org/10.1111/j.1759-6831.2009.00061.x
  • Nordenstam B (1978) Taxonomic studies on the tribe Senecioneae (Compositae). Opera Botanica 44: 1–84.
  • Nordenstam B, Pelser PB (2011) Notes on the generic limits of Sinosenecio and Tephroseris (Compositae-Senecioneae). Compositae Newsletter 49: 1–7.
  • Rédei GP (2008) CLUSTAL W (improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice). Springer Netherlands, 4673–4680. https://doi.org/10.1007/978-1-4020-6754-9_3188
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Tan CJ (2010) Protection and Sustainable Development of Forest Eco-environment in Libo County of Guizhou Province. Anhui Nongye Kexue 38(34): 19468–19470.
  • Vaidya G, Lohman DJ, Meier R (2011) Sequence Matrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27(2): 171–180. https://doi.org/10.1111/j.1096-0031.2010.00329.x

Appendix 1

Table A1.
Download as
CSV
XLSX

GenBank accessions of species used in this study.

Species GenBank accession number of ITS / ndhC-trnV
Tephroseris flammea KU696137 / KU750769
Nemosenecio yunnanensis KU696047 / KU750695
Nemosenecio incisifolius KU696045 / KU750694
Sinosenecio latouchei JQ797428 / KU750748
Sinosenecio latouchei JQ797429 / KU750749
Sinosenecio wuyiensis JQ797431 / KU750764
Sinosenecio jiangxiensis KT149879 / KU750743
Sinosenecio peltatus MK818500 / –
Sinosenecio jiuhuashanicus JQ797426 / KU750746
Sinosenecio jiuhuashanicus JQ797425 / KU750745
Sinosenecio ovatifolius MT522620 / –
Sinosenecio guangxiensis JQ797432 / KU750738
Sinosenecio guangxiensis JF978599 / KU750739
Sinosenecio yangii OM413747 / OM371331
Sinosenecio saxatilis JQ797430 / KU750757
Sinosenecio changii AY176164 / KU750721
Sinosenecio globigerus AY176159 / KU750736
Sinosenecio septilobus AY176161 / KU750758
Sinosenecio bodinieri KT149888 / KU750720
Sinosenecio confervifer KT149891 / KU750723
Sinosenecio fanjingshanicus KT149886 / KU750732
Sinosenecio euosmus JF978589 / KU750730
Sinosenecio oldhamianus JF978616 / KU750753
login to comment