Research Article
Print
Research Article
Hymenophyllum chamaecyparicola (Hymenophyllaceae), a new filmy fern species from Taiwan
expand article infoZhi-Xiang Chang, Tian-Chuan Hsu§|, Li-Yaung Kuo
‡ Taiwan Forestry Research Institute, Yilan, Taiwan
§ Taiwan Forestry Research Institute, Taipei, Taiwan
| National Chung Hsing University, Taichung, Taiwan
¶ National Tsing Hua University, Hsinchu, Taiwan
Open Access

Abstract

Hymenophyllum chamaecyparicola T.C.Hsu & Z.X.Chang, a new filmy fern species (Hymenophyllaceae) has been described from Taiwan and illustrated based on morphological and phylogenetic evidence. Although the new species resembles members in the subgenus Mecodium, namely H. wrightii, our plastid phylogeny has revealed that it is genetically distant from H. wrightii and forms a clade nested within subg. Hymenophyllum. The most notable characteristic to differentiate H. chamaecyparicola from related species is the presence of minute spathulate hairs on the surface of the rachis and veins. Hymenophyllum chamaecyparicola is currently only known from a small area in northern Taiwan, and endemic to that country.

Keywords

Filmy fern, Hymenophyllum, new species, Taiwan

Introduction

Hymenophyllum is the largest subgenus among the ten subgenera in genus Hymenophyllum Sm., and includes at least 100 species (Ebihara et al. 2006; PPG I 2016). Generally, the members of this subgenus are distinguished by their long-creeping rhizomes, pinnate to tripinnate laminae, denticulation on the segment margins, bivalvate involucres, and included receptacles (Ebihara et al. 2006; Hennequin et al. 2010). However, subg. Hymenophyllum as a whole varies greatly in many aspects, including cytology and morphology (Hennequin et al. 2010). With a considerably large number of morphologically disparate species, members of subg. Hymenophyllum have been scattered among different groups or genera in Hymenophyllaceae (Pryer et al. 2001; Ebihara et al. 2002; Hennequin et al. 2003, 2006, 2010; Hennequin 2004) leaving many systematic issues in this subgenus unsettled. In Taiwan, 26 species are currently known to belong to the genus Hymenophyllum. Among them, eight were recognized in subg. Hymenophyllum (Hsu et al. 2019; TPG 2019, 2021), including H. barbatum (Bosch) Baker, H. blandum Racib., H. denticulatum Sw., H. devolii M.J.Lai, H. holochilum (Bosch) C.Chr., H. okadae Masam., H. oligosorum Makino and H. simonsianum Hook. Subgenus Hymenophyllum can be distinguished from its sister subgenus Mecodium by the presence of indumentum along the stipe, rachis, costae and veins vs. these surfaces glabrous in subgen. Mecodium.

In 2019, the first author discovered a Hymenophyllum species with an uncertain assignment in a subtropical montane cloud forest of northern Taiwan. After observing its dwarf habit, superficially glabrous laminae, entire segments, and bivalvate, subentire involucres, we initially considered it to be a member belonging to subg. Mecodium, and tentatively identified it as H. wrightii Bosch, a small species distributed across East Asia and North America (Liu et al. 2013; Lee et al. 2014; Duffy et al. 2015). However, morphological distinctions between the specimen and H. wrightii were observed after careful investigation. This species produces apically distributed sori and minute clavate hairs along the rachis and costae (Figs 1, 2), which are absent in the subg. Mecodium, especially H. wrightii. In this study, we provided not only morphological but also phylogenetic evidence to circumscribe this uncertain species. With no recording of a similar species from previous literature, we determined it as a new species and have described it here as Hymenophyllum chamaecyparicola T.C.Hsu & Z.X.Chang, currently known to be endemic to Taiwan.

Figure 1. 

Habitat and morphology of Hymenophyllum chamaecypericola, from Hsu 11888 (TAIF) A, B wild population growing on moss-covered basal trunk of a giant Chamaecyparis obtusa var. formosana C rhizome and young frond, showing the wingless and scarcely hairy stipe D–G fronds, adaxial views (D, E) and abaxial views (F–G) H, I laminae, adaxial view (F) and abaxial view (G), showing the minute yellow-brown clavate hairs on rachis and veins. J. Sori. Scale bars: 2 cm (B); 5 mm (C, J); 1 cm (D–G); 2 mm (H, I).

Figure 2. 

Line drawing of Hymenophyllum chamaecypericola T.C.Hsu & Z.X.Chang, sp. nov., based on the holotype Z.X. Chang ZXC01438 (TAIF) A rhizome and fronds B sterile frond C fertile frond D sori E a clavate hair.

Materials and methods

Taxon sampling and molecular work

It total, we sampled 19 species, including most members of the East Asian subg. Hymenophyllum, all subg. Mecodium species in Taiwan, and H. imbricatum Blume from subg. Globosa as an outgroup (Hsu et al. 2019). This sampling also included three species from sect. Pseudomecodium, H. exsertum Wall. ex Hook., H. oligosorum and H. pachydermicum Ces., which was demonstrated to have frond characters similar to subg. Mecodium (Iwatsuki 1984, 1985). Their DNA was extracted using a modified CTAB protocol by Kuo (2015). Two chloroplast DNA (cpDNA) regions from these samples were sequenced: rbcL and rps4-trnS (rps4 gene + rps4-trnS intergenic spacer). PCR reactions were each prepared in a 15 μL volume containing 20 ng genomic DNA, 1 × SuperRed PCR Master Mix RED (TOOLS, New Taipei City, Taiwan), and 0.5 μM of each primer. PCR products were then cleaned using ExoSAP-IT (Thermo Fisher Scientific, Waltham, Massachusetts, USA), and sequenced with ABI 3730XL (Thermo Fisher Scientific, Waltham, Massachusetts, USA) by the Genomics BioSci. & Tech. company (New Taipei City, Taiwan). Primers, voucher information and GenBank accession numbers are provided in the Appendices (Appendix 1 and Appendix 2).

Phylogenetic analyses

In total, 49 sequences were used for analyses, including 23 newly generated ones from 13 samples and those used in Hsu et al. (2019) and Chen et al. (2021). These sequences were first aligned using MUSCLE (Edgar 2004) implemented in AliView (Larsson 2014), and the resulting alignments of the two cpDNA regions were then concatenated. Seven partitions were initially identified in the concatenated alignment, including each of three codon positions in rbcL, each of three codon positions in rps4, and rps4-trnS intergenic spacer. The best partition scheme and nucleotide substitution models were inferred by ModelFinder (Kalyaanamoorthy et al. 2017) based on AICc criteria, and applied for maximum likelihood (ML) and Bayesian phylogenetic analysis. IQ-TREE v. 1.6.10 (Nguyen et al. 2015) was used to reconstruct ML phylogeny in CIPRES (Miller et al. 2011) with 1000 standard bootstrap replicates. The Bayesian phylogenetic analysis was performed using MrBayes v.3.2.6 (Ronquist et al. 2012) in CIPRES (Miller et al. 2011) with two simultaneous runs and four chains. In each chain, 20 million generations were run, and sampled every 1000 generations. Tracer v. 1.7.1 (Rambaut and Drummond 2013) was used to determine the convergence through generations among chains. The first 25% of the generations was discarded as burn-in, and the posterior probabilities (PP) as branch supports of a Bayesian tree were then summarized.

Results

The concatenated cpDNA dataset of rbcL (1365 bp) and rps4-trnS (1125 bp) contained a total of 2490 aligned sites. In our cpDNA phylogeny (Fig. 3), no conflicting relationship was found between ML and Bayesian trees. Our two samples of the uncertain Hymenophyllum (H. chamaecyparicola sp. nov.) possessed identical cpDNA sequences, and this species was found to be phylogenetically unrelated to H. wrightii in subg. Mecodium. Instead, it formed a strongly supported clade embedded in subg. Hymenophyllum and was well separated from all other species (Fig. 3). Interestingly, subg. Hymenophyllum as defined by Ebihara et al. (2006) was revealed to be non-monophyletic in our phylogenies because H. simosianum was found sister to subg. Mecodium with weak supporting values (BS/PP=73/0.6).

Figure 3. 

Maximum likelihood (ML) phylogeny of Hymenophyllum subg. Hymenophyllum and Hymenophyllum subg. Mecodium based on the chloroplast DNA dataset (rbcL + rps4-trnS). Branch support is indicated in ML bootstrap/ BI posterior probabilities.

Taxonomic treatment

Hymenophyllum chamaecyparicola T.C.Hsu & Z.X.Chang, sp. nov.

Figs 1, 2

Type

Taiwan. Yilan County: Datong Township, Mingchih, 1200–1300 m, 31 January 2019, Z.X. Chang ZXC01438 (holotype: TAIF; isotype: TAI).

Diagnosis

Morphologically, Hymenophyllum chamaecyparicola is most similar to H. wrightii in sharing pinnate to bipinnatifid fronds, entire segment margins, and bivalvate, entire or subentire involucres. However, the new species could be clearly distinguished from H. wrightii by the presence of minute spathulate hairs on both surfaces of laminae (vs. glabrous laminae in H. wrightii) (Fig. 1H, I), the lack of two veinlets at the base of sori (vs. two veinlets at the base of sori in H. wrightii), and sori confined to apex or upper margins of laminae (vs. on short acroscopic segments close to rachis in H. wrightii) (Fig. 1J). This new species is phylogenetically related to H. barbatum, H. devolii, H. exsertum, H. okadae and H. oligosorum, while it could readily be distinguished from H. barbatum, H. devolii and H. okadae in having entire (vs. serrate) segment margins (Fig. 1D–G) and from H. exsertum and H. oligosorum in having pinnatifid to bipinnatifid (vs. bipinnatifid to tripinnatifid) laminae (Fig. 1D–G) sparsely covered with short (< 0.2 mm) clavate hairs (vs. densely covered with > 1 mm long acicular hairs) on abaxial surface of rachis and costae (Figs 1H, I, 2E).

Description

Plants epiphytic. Rhizomes long creeping, blackish brown, 0.2–0.3 mm in diam, covered with caducous golden brown multicellular hairs, turning glabrescent when aged. Fronds (1)3–7(10) mm apart, (0.7)1–2.5(4.5) cm long, usually pendent. Stipes dark brownish, (1)2–12(25) mm long, ca. 0.15 mm in diam., wingless, with very sparse caducous hairs similar to those on the rhizomes, turning glabrescent when aged. Laminae pinnatifid to bipinnatifid, flabellate-orbicular, ovate or elliptic, (0.8)1–2.2(3.5) × (0.4)0.6–1.1(1.5) cm, membranous, base obtuse, apex rounded, with minute pale brownish clavate hairs along both surfaces of rachis, costae and veins, otherwise glabrous; clavate hairs up to 0.15 mm long, very sparse adaxially, sparse to scattered abaxially; rachises brown, slightly zigzag, winged throughout or sometimes wingless at base, wings up to ca. 0.2 mm wide, flat, entire; pinnae 2–4(5) pairs, alternate, forming acute angles with rachis, lower pinnae usually forked, rarely more dissected, upper pinnae usually simple, (2)3–8(11) mm long; ultimate segments oblong, (1)2–7(10) × 1.2–1.5 mm, apex rounded, entire, flat or slightly involute; veins simple, greenish brown, ending slightly below the apical margin. Sori 1–3(6) per lamina, confined to apex of lamina or sometimes scattered along upper margins, solitary and terminal on ultimate segments, segment lamina usually slightly constricted below sori; involucres bivalvate, orbicular, ovate-orbicular or elliptic, 1.2–2 × 1–1.5 mm, with a few minute clavate hairs at base, margins entire or minutely erose; receptacles inserted. Spores chlorophyllous, 64 per sporangium.

Additional specimen examined

Taiwan. Yilan County: Datong Township, Mingchih, 1200–1300 m, 11 February 2019, Chang ZXC01440 (TAIF); same loc., 11 July 2019, Chang ZXC01670 (TAIF); same loc. and date, Hsu 11888 (TAIF).

Distribution and habitat

Hymenophyllum chamaecyparicola is endemic to Taiwan and currently known from scattered populations on a single ca. 2000 m2 mountain slope in Chamaecyparis montane mixed cloud forest (Li et al. 2013) around Mingchih (24.65361°N, 121.46950°E). It is epiphytic on bases of tree trunks and exposed roots of Chamaecyparis obtusa var. formosana (Hayata) Hayata.

Etymology

The specific epithet, a noun in apposition, is derived from Chamaecyparis, a Gymnosperm genus, and –cola, dweller, alluding to unusual habitat of the new species occurring on the lower trunk of the giant C. obtusa var. formosana.

Discussion

Our phylogeny generally agrees with the “modern” circumscriptions of Hymenophyllum subg. Hymenophyllum and subg. Mecodium (Ebihara et al. 2006; Hennequin et al. 2010; Hsu et al. 2019; Vasques et al. 2019) with only one exception – H. simonsianum, which was placed within subg. Hymenophyllum based on morphology (Ebihara et al. 2006) but resolved here as an isolated lineage sister to subg. Mecodium (Fig. 3). Given that this unexpected position of H. simonsianum was weakly supported in our tree based on only two cpDNA regions, we consider that more sequence data is required to ascertain its systematic placement.

The phylogenetic position of Hymenophyllum chamaecyparicola, nested within subg. Hymenophyllum, was somewhat surprising in the beginning due to its superficial resemblance to H. wrightii in subg. Mecodium. However, after a detailed examination of the specimens, we concluded that its placement in subg. Hymenophyllum is also morphologically evident. Though hardly visible to the naked eye, H. chamaecyparicola bears clavate hairs on stipes and rachis, and such laminar trichomes are common in subg. Hymenophyllum but absent in subg. Mecodium (Ebihara et al. 2006; Hennequin et al. 2010; Hsu et al. 2019). Moreover, from our examination, two veinlets can be found at the bases of sori in members of subg. Mecodium sori but not in H. chamaecyparicola and other species of subg. Hymenophyllum as implied previously (Dubuisson et al. 2018).

Obviously, our sampling of Hymenophyllum subg. Hymenophyllum (11 species), with an estimate of more than 100 species (Ebihara et al. 2006), remains insufficient. Even so, this study still provides some insights about interspecific relationships and systematics within this subgenus. We revealed for the first time that sect. Pseudomecodium, mainly defined by the combination of abaxially hairy veins and entire segments (Iwatsuki 1984, 1985), is non-monophyletic. In our tree, the four sampled species with entire segments, including H. chamaecyparicola, H. exsertum, H. oligosorum and H. pachydermicum, were placed in three different lineages (Fig. 3). In addition, our data strongly supported that H. okadae, recently reinstated from a synonym of H. barbatum based on a few subtle morphological characters (Knapp and Hsu 2017), is also phylogenetically distinct.

In addition to H. chamaecyparicola, H. devolii is another subg. Hymenophyllum species endemic to Taiwan. Our study then revealed that H. devolii is affiliated, not only morphologically but also phylogenetically, with its sympatric relatives, H. okadae and H. barbatum, which are also distributed in other East Asian regions. It will be very worthy to further study the speciation pathways behind these endemic ferns in Taiwan. A comprehensive sampling in the subgenus, especially from Southeast Asia, and a dated phylogeny are ultimately necessary to clarify the evolutionary history of these Taiwan endemic ferns.

Key to subg. Hymenophyllum and Mecodium species in Taiwan

1 Laminae glabrous, indumentum absent along the stipes, rachises, and veins 2
Indumentum present along the stipes, rachises, and veins 6
2 Stipes wingless or only with decurrent wings at apexes 3
Stipes narrowly winged to base or at least to middle 4
3 Stipes reddish brown, wingless; involucres orbicular, distinctly wider than joint segments H. punctisorum
Stipes dark brownish, only with decurrent wings at apexes; involucres ovate-orbicular or ovate, roughly as wide as joint segments H. parallelocarpum
4 Laminae shorter than 6 cm; sori densely aggregated at lamina apexes H. paniculiflorum
Laminae variable; sori never densely aggregated at lamina apexes 5
5 Rachis and costa wings weakly crispate or flat; ultimate segments nearly flat; involucres ovate to ovate-triangular H. fujisanense
Rachis and costa wings strongly crispate; ultimate segments contorted; involucres oval to suborbicular H. exquisitum
6 Segment margins entire 7
Segment margins serrate 8
7 Laminae pinnatifid to bipinnatifid; minute pale brownish clavate hairs (ca. < 0.2 mm) present on both surfaces of rachises and veins H . chamaecyparicola
Laminae bipinnate to tripinnatifid; brownish setae (ca. > 1 mm) present on both surfaces of rachises and veins H. oligosorum
8 Involucres obconic-tubular; receptacles exserted 9
Involucres cleft to base, not obconic-tubular; receptacles included in involucres 11
9 Stipes and rachises wingless; involucres serrate at apexes H . blandum
Stipes and rachises winged; involucres entire or toothed at apexes 10
10 Laminae crispate; involucres toothed; spine-like protrusions present on base of involucres H . denticulatum
Laminae flat; involucres entire; spine-like protrusions absent on base of involucres H . holochilum
11 Involucres orbicular to ovate 12
Involucres oblong to oval 13
12 Rachis wings involute; involucres orbicular to oblate, dentate at apexes H . okadae
Rachis wings recurved to revolute; involucres orbicular to ovate, entire or sometimes slightly crenate at apexes H . devolii
13 Laminae ovate; segments 2 mm broad; costae of sterile pinna with more than 2 pairs of costules H . barbatum
Laminae linear-oblong to linear-lanceolate; segments 2–4 mm broad; costae of sterile pinna only with 1 or 2 pair of costules H . simonsianum

Acknowledgements

We are grateful to Ralf Knapp for his useful comments and enthusiastic participation in field trips. We thank Chih-Yun Sun for preparing line drawings; Alexandria Quinlan for English edits; the curators of K, L, MICH, NY, P, TAI, TAIF and US herbaria for access to their collections; Taiwan Pteridophyte Group (TPG) for maintaining DNA collections used in this study; Cheng-Wei Chen and Pei-Jung Xie for generating DNA sequences; Diego Tavares Vasques, Atsushi Ebihara, Joel Nitta, and one anonymous reviewer for their comments on the manuscript. This project was supported by MOST project (109-2621-B-007-001-MY3, 111-2628-B-007-006-MY3) in Taiwan, the Bioresource Conservation Research Center in College of Life Science from the Higher Education Sprout Project by MOE, Biodiversity Information Fund for Asia project (BIFA6_010).

References

  • Dubuisson J-Y, Pechon TL, Bauret L, Rouhan G, Reeb C, Boucheron-Dubuisson E, Selosse M-A, Chaussidon C, Dajoz I, Pynee K, Grangaud E, Robert Y, Tamon J-M, Hennequin S (2018) Disentangling the diversity and taxonomy of Hymenophyllaceae (Hymenophyllales, Polypodiiadae) in the Mascarene archipelago, with ecological implications. Phytotaxa 375(1): 1–58. https://doi.org/10.11646/phytotaxa.375.1.1
  • Duffy AM, Stensvold MC, Farrar DR (2015) Independent gametophytes of Hymenophyllum wrightii in North America: Not as rare as we thought. American Fern Journal 105(1): 45–55. https://doi.org/10.1640/0002-8444-105.1.45
  • Ebihara A, Iwatsuki K, Kurita S, Ito M (2002) Systematic position of Hymenophyllum rolandi-principis Rosenst. or a monotypic genus Rosenstockia Copel. (Hymenophyllaceae) endemic to New Caledonia. Acta Phytotaxonomica et Geobotanica 53(1): 35–49. https://doi.org/10.18942/apg.KJ00003256664
  • Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32(5): 1792–1797. https://doi.org/10.1093/nar/gkh340
  • Hasebe M, Omori T, Nakazawa M, Sano T, Kato M, Iwatsuki K (1994) RbcL gene sequences provide evidence for the evolutionary lineages of leptosporangiate ferns. Proceedings of the National Academy of Sciences of the United States of America 91(12): 5730–5734. https://doi.org/10.1073/pnas.91.12.5730
  • Hennequin S (2004) Le genre Hymenophyllum Sm. (Hymenophyllaceae, Filicopsida): systématique phylogénétique, évolution morphologique et histoire biogéographique. Ph. D. Thesis, Pierre and Marie Curie University Paris, France.
  • Hennequin S, Ebihara A, Ito M, Iwatsuki K, Dubuisson J-Y (2003) Molecular systematics of the fern genus Hymenophyllum s.l. (Hymenophyllaceae) based on chloroplastic coding and noncoding regions. Molecular Phylogenetics and Evolution 27(2): 283–301. https://doi.org/10.1016/S1055-7903(02)00404-9
  • Hennequin S, Ebihara A, Ito M, Iwatsuki K, Dubuisson J-Y (2006) New insights into the phylogeny of the genus Hymenophyllum s.l. (Hymenophyllaceae): Revealing the polyphyly of Mecodium. Systematic Botany 31(2): 271–284. https://doi.org/10.1600/036364406777585775
  • Hennequin S, Ebihara A, Dubuisson J-Y, Schneider H (2010) Chromosome number evolution in Hymenophyllum (Hymenophyllaceae), with special reference to the subgenus Hymenophyllum. Molecular Phylogenetics and Evolution 55(1): 47–59. https://doi.org/10.1016/j.ympev.2010.01.001
  • Iwatsuki K (1985) The Hymenophyllaceae of Asia, excluding Malesia. Journal of the Faculty of Science, University of Tokyo, section III. Botany 13: 501–551.
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285
  • Knapp R, Hsu T-C (2017) Ferns and Fern Allies of Taiwan. Second Supplement. KBCC Press, Pingtung, Taiwan.
  • Kuo L-Y (2015) Polyploidy and biogeography in genus Deparia and phylogeography in Deparia lancea. Ph. D. Thesis, National Taiwan University, Taiwan.
  • Li C-F, Chytrý M, Zelený D, Chen M-Y, Chen T-Y, Chiou C-R, Hsia Y-J, Liu H-Y, Yang S-Z, Yeh C-L, Wang J-C, Yu C-F, Lai Y-J, Chao W-C, Hsieh C-F (2013) Classification of Taiwan forest vegetation. Applied Vegetation Science 16(4): 698–719. https://doi.org/10.1111/avsc.12025
  • Liu J, Zhang Q, Ebihara A, Iwatsuki K (2013) Hymenophyllaceae. In: Wu Z, Raven PH, Hong D (Eds) Flora of China, vol. 2–3. Missouri Botanical Garden Press, Beijing, China, St. Louis, USA, 93–109.
  • Miller MA, Pfeiffer W, Schwartz T (2011) The CIPRES science gateway: A community resource for phylogenetic analyses. In: Towns JW (Ed.) Proceedings of the 2011 TeraGrid Conference: Extreme Digital Discovery ACM. New Orleans, LA, 1–8.
  • Nadot S, Bajon R, Lejeune B (1994) The chloroplast gene rps4 as a tool for the study of Poaceae phylogeny. Plant Systematics and Evolution 191(1–2): 27–38. https://doi.org/10.1007/BF00985340
  • Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • PPG I (2016) A community-derived classification for extant lycophytes and ferns. Journal of Systematics and Evolution 54(6): 563–603. https://doi.org/10.1111/jse.12229
  • Pryer KM, Smith AR, Hunt JS, Dubuisson J-Y (2001) RbcL data reveal two monophyletic groups of filmy ferns (Filicopsida: Hymenophyllaceae). American Journal of Botany 88(6): 1118–1130. https://doi.org/10.2307/2657095
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Souza-Chies TT, Bittar G, Nadot S, Carter L, Besin E, Lejeune B (1997) Phylogenetic analysis of Iridaceae with parsimony and distance methods using the plastid gene rps4. Plant Systematics and Evolution 204(1–2): 109–123. https://doi.org/10.1007/BF00982535
  • Vasques DT, Ebihara A, Hirai RY, Prado J, Motomi I (2019) Phylogeny of Hymenophyllum subg. Mecodium (Hymenophyllaceae), with special focus on the diversity of the Hymenophyllum polyanthos species complex. Plant Systematics and Evolution 305(9): 811–825. https://doi.org/10.1007/s00606-019-01609-y

Appendix 1

Table A1.

Voucher and sequence information of Hymenophyllum species for the phylogenetic analyses. GenBank accessions (rps4- trnS and rbcL) are under their columns, respectively. The symbol “–” means not available; the symbol “* ” means newly generated sequences in this study.

Taxon Voucher specimen number Collection locality Herbarium rps4-trnS rbcL
H. barbatum Hsu 8586 Taiwan (Taoyuan County) TAIF ON773153* ON652817*
H. blandum Kuo 2377 Taiwan (Yilan County) TAIF ON773147* ON773829*
H. bryoides Wade 5785 Vietnam TAIF MW478759 MW478758
H. chamaecyparicola ZXC001440 Taiwan (Yilan County) TAIF ON773148* ON773830*
H. chamaecyparicola ZXC001438 Taiwan (Yilan County) TAIF ON773149* ON773831*
H. denticulatum Kuo 872 Taiwan (Pingtung County) TAIF ON773146* ON773828*
H. denticulatum Kuo 2375 Taiwan (Yilan County) TAIF ON773827*
H. devolii Knapp 3019 Taiwan (Taitung County) P MF144616 MF144660
H. devolii Lu 27866 Taiwan (Taitung County) TAIF ON773833*
H. devolii Hsu 6273 Taiwan (Taitung County) TAIF MN266569 MN266660
H. exquistum Hsu 5773 Taiwan (Hsinchu County) TAIF MH211098 MH211069
H. exsertum Fraser-Jenkins-FN123 India TAIF ON773154 * ON773836*
H. fujisanense Hsu 6902 Taiwan (Taitung County) TAIF MH211087 MH211058
H. holochilum Kuo 4290 Taiwan (Pingtung County) TAIF MH265124 MH265124
H. imbricatum Kuo 3535 Philippines TAIF MH211105 MH211076
H. okadae Hsu 5853 Taiwan (Taoyuan County) TAIF MH211103 MH211074
H. okadae Kuo 2329 Taiwan (Yilan County) TAIF ON773145* ON773826*
H. oligosorum Kuo 2378 Taiwan (Yilan County) TAIF ON773825*
H. oligosorum Hsu 5646 Taiwan (Hualien County) TAIF MH211102 MH211073
H. pachydermicum Hsu 11307 Vietnam TAIF ON773151* ON773834*
H. pachydermicum Wade 4135 Vietnam TAIF ON773152* ON773835*
H. paniculiflorum Hsu 5909 Taiwan (Taichung County) TAIF MH211097 MH211068
H. parallelocarpum Hsu 7127 Taiwan (Pingtung County) TAIF MH211101 MH211072
H. punctisorum Hsu 7349 Taiwan (Nantou County) TAIF MH211083 MH211054
H. simonsianum ZXC001955 Taiwan (Nantou County) TAIF ON773150* ON773832*
H. wrightii Ebihara000901-01 Japan TI AY775430 AB083277

Appendix 2

Table A2.

Primers used in this study.

Name Region Sequence (5’-3’) Reference
aF rbcL ATGTCACCACAAACAGAGACTAAAGC Hasebe et al. 1994
1379R rbcL TCACAAGCAGCAGCTAGTTCAGGACTC Pryer et al. 2001
Fern rbcL fVGF rbcL GAGACTAAAGCAGGTGTTGGATTCA This study
Fern rbcL rVVG rbcL GTTCCCCYTCTAGTTTRCCTACTAC This study
rps5 rps4-trnS ATGTCCCGTTATCGAGGACCT Nadot et al. 1994
trnS rps4-trnS TACCGAGGGTTCGAATC Souza-Chies et al. 1997
login to comment