Research Article |
Corresponding author: Li-Yaung Kuo ( lykuo@life.nthu.edu.tw ) Academic editor: Joel Nitta
© 2022 Zhi-Xiang Chang, Tian-Chuan Hsu, Li-Yaung Kuo.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Chang Z-X, Hsu T-C, Kuo L-Y (2022) Hymenophyllum chamaecyparicola (Hymenophyllaceae), a new filmy fern species from Taiwan. PhytoKeys 204: 23-34. https://doi.org/10.3897/phytokeys.204.86045
|
Hymenophyllum chamaecyparicola T.C.Hsu & Z.X.Chang, a new filmy fern species (Hymenophyllaceae) has been described from Taiwan and illustrated based on morphological and phylogenetic evidence. Although the new species resembles members in the subgenus Mecodium, namely H. wrightii, our plastid phylogeny has revealed that it is genetically distant from H. wrightii and forms a clade nested within subg. Hymenophyllum. The most notable characteristic to differentiate H. chamaecyparicola from related species is the presence of minute spathulate hairs on the surface of the rachis and veins. Hymenophyllum chamaecyparicola is currently only known from a small area in northern Taiwan, and endemic to that country.
Filmy fern, Hymenophyllum, new species, Taiwan
Hymenophyllum is the largest subgenus among the ten subgenera in genus Hymenophyllum Sm., and includes at least 100 species (
In 2019, the first author discovered a Hymenophyllum species with an uncertain assignment in a subtropical montane cloud forest of northern Taiwan. After observing its dwarf habit, superficially glabrous laminae, entire segments, and bivalvate, subentire involucres, we initially considered it to be a member belonging to subg. Mecodium, and tentatively identified it as H. wrightii Bosch, a small species distributed across East Asia and North America (
Habitat and morphology of Hymenophyllum chamaecypericola, from Hsu 11888 (TAIF) A, B wild population growing on moss-covered basal trunk of a giant Chamaecyparis obtusa var. formosana C rhizome and young frond, showing the wingless and scarcely hairy stipe D–G fronds, adaxial views (D, E) and abaxial views (F–G) H, I laminae, adaxial view (F) and abaxial view (G), showing the minute yellow-brown clavate hairs on rachis and veins. J. Sori. Scale bars: 2 cm (B); 5 mm (C, J); 1 cm (D–G); 2 mm (H, I).
It total, we sampled 19 species, including most members of the East Asian subg. Hymenophyllum, all subg. Mecodium species in Taiwan, and H. imbricatum Blume from subg. Globosa as an outgroup (
In total, 49 sequences were used for analyses, including 23 newly generated ones from 13 samples and those used in
The concatenated cpDNA dataset of rbcL (1365 bp) and rps4-trnS (1125 bp) contained a total of 2490 aligned sites. In our cpDNA phylogeny (Fig.
Taiwan. Yilan County: Datong Township, Mingchih, 1200–1300 m, 31 January 2019, Z.X. Chang ZXC01438 (holotype: TAIF; isotype: TAI).
Morphologically, Hymenophyllum chamaecyparicola is most similar to H. wrightii in sharing pinnate to bipinnatifid fronds, entire segment margins, and bivalvate, entire or subentire involucres. However, the new species could be clearly distinguished from H. wrightii by the presence of minute spathulate hairs on both surfaces of laminae (vs. glabrous laminae in H. wrightii) (Fig.
Plants epiphytic. Rhizomes long creeping, blackish brown, 0.2–0.3 mm in diam, covered with caducous golden brown multicellular hairs, turning glabrescent when aged. Fronds (1)3–7(10) mm apart, (0.7)1–2.5(4.5) cm long, usually pendent. Stipes dark brownish, (1)2–12(25) mm long, ca. 0.15 mm in diam., wingless, with very sparse caducous hairs similar to those on the rhizomes, turning glabrescent when aged. Laminae pinnatifid to bipinnatifid, flabellate-orbicular, ovate or elliptic, (0.8)1–2.2(3.5) × (0.4)0.6–1.1(1.5) cm, membranous, base obtuse, apex rounded, with minute pale brownish clavate hairs along both surfaces of rachis, costae and veins, otherwise glabrous; clavate hairs up to 0.15 mm long, very sparse adaxially, sparse to scattered abaxially; rachises brown, slightly zigzag, winged throughout or sometimes wingless at base, wings up to ca. 0.2 mm wide, flat, entire; pinnae 2–4(5) pairs, alternate, forming acute angles with rachis, lower pinnae usually forked, rarely more dissected, upper pinnae usually simple, (2)3–8(11) mm long; ultimate segments oblong, (1)2–7(10) × 1.2–1.5 mm, apex rounded, entire, flat or slightly involute; veins simple, greenish brown, ending slightly below the apical margin. Sori 1–3(6) per lamina, confined to apex of lamina or sometimes scattered along upper margins, solitary and terminal on ultimate segments, segment lamina usually slightly constricted below sori; involucres bivalvate, orbicular, ovate-orbicular or elliptic, 1.2–2 × 1–1.5 mm, with a few minute clavate hairs at base, margins entire or minutely erose; receptacles inserted. Spores chlorophyllous, 64 per sporangium.
Taiwan. Yilan County: Datong Township, Mingchih, 1200–1300 m, 11 February 2019, Chang ZXC01440 (TAIF); same loc., 11 July 2019, Chang ZXC01670 (TAIF); same loc. and date, Hsu 11888 (TAIF).
Hymenophyllum chamaecyparicola is endemic to Taiwan and currently known from scattered populations on a single ca. 2000 m2 mountain slope in Chamaecyparis montane mixed cloud forest (
The specific epithet, a noun in apposition, is derived from Chamaecyparis, a Gymnosperm genus, and –cola, dweller, alluding to unusual habitat of the new species occurring on the lower trunk of the giant C. obtusa var. formosana.
Our phylogeny generally agrees with the “modern” circumscriptions of Hymenophyllum subg. Hymenophyllum and subg. Mecodium (
The phylogenetic position of Hymenophyllum chamaecyparicola, nested within subg. Hymenophyllum, was somewhat surprising in the beginning due to its superficial resemblance to H. wrightii in subg. Mecodium. However, after a detailed examination of the specimens, we concluded that its placement in subg. Hymenophyllum is also morphologically evident. Though hardly visible to the naked eye, H. chamaecyparicola bears clavate hairs on stipes and rachis, and such laminar trichomes are common in subg. Hymenophyllum but absent in subg. Mecodium (
Obviously, our sampling of Hymenophyllum subg. Hymenophyllum (11 species), with an estimate of more than 100 species (
In addition to H. chamaecyparicola, H. devolii is another subg. Hymenophyllum species endemic to Taiwan. Our study then revealed that H. devolii is affiliated, not only morphologically but also phylogenetically, with its sympatric relatives, H. okadae and H. barbatum, which are also distributed in other East Asian regions. It will be very worthy to further study the speciation pathways behind these endemic ferns in Taiwan. A comprehensive sampling in the subgenus, especially from Southeast Asia, and a dated phylogeny are ultimately necessary to clarify the evolutionary history of these Taiwan endemic ferns.
1 | Laminae glabrous, indumentum absent along the stipes, rachises, and veins | 2 |
– | Indumentum present along the stipes, rachises, and veins | 6 |
2 | Stipes wingless or only with decurrent wings at apexes | 3 |
– | Stipes narrowly winged to base or at least to middle | 4 |
3 | Stipes reddish brown, wingless; involucres orbicular, distinctly wider than joint segments | H. punctisorum |
– | Stipes dark brownish, only with decurrent wings at apexes; involucres ovate-orbicular or ovate, roughly as wide as joint segments | H. parallelocarpum |
4 | Laminae shorter than 6 cm; sori densely aggregated at lamina apexes | H. paniculiflorum |
– | Laminae variable; sori never densely aggregated at lamina apexes | 5 |
5 | Rachis and costa wings weakly crispate or flat; ultimate segments nearly flat; involucres ovate to ovate-triangular | H. fujisanense |
– | Rachis and costa wings strongly crispate; ultimate segments contorted; involucres oval to suborbicular | H. exquisitum |
6 | Segment margins entire | 7 |
– | Segment margins serrate | 8 |
7 | Laminae pinnatifid to bipinnatifid; minute pale brownish clavate hairs (ca. < 0.2 mm) present on both surfaces of rachises and veins | H . chamaecyparicola |
– | Laminae bipinnate to tripinnatifid; brownish setae (ca. > 1 mm) present on both surfaces of rachises and veins | H. oligosorum |
8 | Involucres obconic-tubular; receptacles exserted | 9 |
– | Involucres cleft to base, not obconic-tubular; receptacles included in involucres | 11 |
9 | Stipes and rachises wingless; involucres serrate at apexes | H . blandum |
– | Stipes and rachises winged; involucres entire or toothed at apexes | 10 |
10 | Laminae crispate; involucres toothed; spine-like protrusions present on base of involucres | H . denticulatum |
– | Laminae flat; involucres entire; spine-like protrusions absent on base of involucres | H . holochilum |
11 | Involucres orbicular to ovate | 12 |
– | Involucres oblong to oval | 13 |
12 | Rachis wings involute; involucres orbicular to oblate, dentate at apexes | H . okadae |
– | Rachis wings recurved to revolute; involucres orbicular to ovate, entire or sometimes slightly crenate at apexes | H . devolii |
13 | Laminae ovate; segments 2 mm broad; costae of sterile pinna with more than 2 pairs of costules | H . barbatum |
– | Laminae linear-oblong to linear-lanceolate; segments 2–4 mm broad; costae of sterile pinna only with 1 or 2 pair of costules | H . simonsianum |
We are grateful to Ralf Knapp for his useful comments and enthusiastic participation in field trips. We thank Chih-Yun Sun for preparing line drawings; Alexandria Quinlan for English edits; the curators of K, L, MICH, NY, P, TAI, TAIF and US herbaria for access to their collections; Taiwan Pteridophyte Group (TPG) for maintaining DNA collections used in this study; Cheng-Wei Chen and Pei-Jung Xie for generating DNA sequences; Diego Tavares Vasques, Atsushi Ebihara, Joel Nitta, and one anonymous reviewer for their comments on the manuscript. This project was supported by MOST project (109-2621-B-007-001-MY3, 111-2628-B-007-006-MY3) in Taiwan, the Bioresource Conservation Research Center in College of Life Science from the Higher Education Sprout Project by MOE, Biodiversity Information Fund for Asia project (BIFA6_010).
Voucher and sequence information of Hymenophyllum species for the phylogenetic analyses. GenBank accessions (rps4- trnS and rbcL) are under their columns, respectively. The symbol “–” means not available; the symbol “* ” means newly generated sequences in this study.
Taxon | Voucher specimen number | Collection locality | Herbarium | rps4-trnS | rbcL |
---|---|---|---|---|---|
H. barbatum | Hsu 8586 | Taiwan (Taoyuan County) | TAIF | ON773153* | ON652817* |
H. blandum | Kuo 2377 | Taiwan (Yilan County) | TAIF | ON773147* | ON773829* |
H. bryoides | Wade 5785 | Vietnam | TAIF | MW478759 | MW478758 |
H. chamaecyparicola | ZXC001440 | Taiwan (Yilan County) | TAIF | ON773148* | ON773830* |
H. chamaecyparicola | ZXC001438 | Taiwan (Yilan County) | TAIF | ON773149* | ON773831* |
H. denticulatum | Kuo 872 | Taiwan (Pingtung County) | TAIF | ON773146* | ON773828* |
H. denticulatum | Kuo 2375 | Taiwan (Yilan County) | TAIF | – | ON773827* |
H. devolii | Knapp 3019 | Taiwan (Taitung County) | P | MF144616 | MF144660 |
H. devolii | Lu 27866 | Taiwan (Taitung County) | TAIF | – | ON773833* |
H. devolii | Hsu 6273 | Taiwan (Taitung County) | TAIF | MN266569 | MN266660 |
H. exquistum | Hsu 5773 | Taiwan (Hsinchu County) | TAIF | MH211098 | MH211069 |
H. exsertum | Fraser-Jenkins-FN123 | India | TAIF | ON773154 * | ON773836* |
H. fujisanense | Hsu 6902 | Taiwan (Taitung County) | TAIF | MH211087 | MH211058 |
H. holochilum | Kuo 4290 | Taiwan (Pingtung County) | TAIF | MH265124 | MH265124 |
H. imbricatum | Kuo 3535 | Philippines | TAIF | MH211105 | MH211076 |
H. okadae | Hsu 5853 | Taiwan (Taoyuan County) | TAIF | MH211103 | MH211074 |
H. okadae | Kuo 2329 | Taiwan (Yilan County) | TAIF | ON773145* | ON773826* |
H. oligosorum | Kuo 2378 | Taiwan (Yilan County) | TAIF | – | ON773825* |
H. oligosorum | Hsu 5646 | Taiwan (Hualien County) | TAIF | MH211102 | MH211073 |
H. pachydermicum | Hsu 11307 | Vietnam | TAIF | ON773151* | ON773834* |
H. pachydermicum | Wade 4135 | Vietnam | TAIF | ON773152* | ON773835* |
H. paniculiflorum | Hsu 5909 | Taiwan (Taichung County) | TAIF | MH211097 | MH211068 |
H. parallelocarpum | Hsu 7127 | Taiwan (Pingtung County) | TAIF | MH211101 | MH211072 |
H. punctisorum | Hsu 7349 | Taiwan (Nantou County) | TAIF | MH211083 | MH211054 |
H. simonsianum | ZXC001955 | Taiwan (Nantou County) | TAIF | ON773150* | ON773832* |
H. wrightii | Ebihara000901-01 | Japan | TI | AY775430 | AB083277 |
Name | Region | Sequence (5’-3’) | Reference |
---|---|---|---|
aF | rbcL | ATGTCACCACAAACAGAGACTAAAGC |
|
1379R | rbcL | TCACAAGCAGCAGCTAGTTCAGGACTC |
|
Fern rbcL fVGF | rbcL | GAGACTAAAGCAGGTGTTGGATTCA | This study |
Fern rbcL rVVG | rbcL | GTTCCCCYTCTAGTTTRCCTACTAC | This study |
rps5 | rps4-trnS | ATGTCCCGTTATCGAGGACCT |
|
trnS | rps4-trnS | TACCGAGGGTTCGAATC |
|