Research Article |
Corresponding author: Xing-Jin He ( xjhe@scu.edu.cn ) Academic editor: Lorenzo Peruzzi
© 2022 Deng-Feng Xie, Rui-Yu Cheng, Megan Price, Jun-Pei Chen, Jia-Qing Lei, Yi-Yang Zhang, Xing-Jin He.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Xie D-F, Cheng R-Y, Price M, Chen J-P, Lei J-Q, Zhang Y-Y, He X-J (2022) Allium heterophyllum (Amaryllidaceae), a new species from Henan, China. PhytoKeys 190: 53-67. https://doi.org/10.3897/phytokeys.190.77449
|
Allium heterophyllum D.F.Xie & X.J.He, sp. nov. (Amaryllidaceae), is a new species from Henan, China and is described based on morphological and molecular evidence. It is morphologically most similar to A. dumebuchum in the rhomboid scape in cross-section. However, distinctive differences were detected in perianth color, leaf shape and cross-section, flowers’ density as well as flowering season. Similarly, the karyotype of A. heterophyllum is 2n = 2x = 16 and in A. dumebuchum is 2n = 4x = 32. Phylogenetic analysis based on nuclear ribosomal Internal Transcribed Spacers (ITS) and three cpDNA regions strongly supports that A. heterophyllum is a member of Allium section Rhizirideum and sister to the other species of this section (e.g. A. senescens, A. spirale, and A. prostratum). Currently, only one population and approximately 120 individuals were discovered; the development of scenic spots in this region may affect its growth and threaten this population. Therefore, this new species is preliminarily considered as Near Threatened (NT) according to criteria of the IUCN Red List.
Allium, chromosome number, morphology, new species, phylogenetic analysis
Allium L. is one of the largest genera of Amaryllidaceae (
The typical section of Allium subgenus Rhizirideum (G.Don ex W.D.J.Koch) Wendelbo, section Rhizirideum G.Don ex W.D.J.Koch has 25 species (including the recently published new species A. dumebuchum) (
Previous phylogenetic studies suggested that the section Rhizirideum is a strong monophyletic unit (
Many new Allium species have been described this year (
Living plants and samples of Allium heterophyllum were collected in Songxian county (33°41'25.61"N, 111°59'24.31"E, Altitude: 1347 m), Henan province, China. Voucher specimens were deposited at the herbarium of Sichuan University (
Root tips were excised from the bulbs and pre-treated in saturated p-dichlorobenzene at 4 °C for 9 hours in the absence of light, then rinsed twice using distilled water and transferred to 3:1 ethanol-acetic acid for 10 hours. Subsequently, we rinsed the samples twice with distilled water and hydrolyzed in 1 mol/L HCL at 60 °C for 10 min. Finally, the samples were stained with the improved carbolfuchsin for one hour and squashed for observation. More than ten individuals were checked with three to five plates being investigated for each individual and well-spread metaphase plates were observed and further photographed using the Olympus BX43 electron microscope (Tokyo, Japan).
Total DNA was extracted from silica gel dried young leaves of the new species using the Tiangen plant genomic DNA extraction kit (Tiangen Biotech, Beijing) according to the protocols of the manufacturer. The complete nucleotide ribosomal ITS region (ITS1, 5.8S and ITS2) was amplified using the ITS primers from
Primers and amplification information were used for DNA barcoding in this study.
Fragment | Marker | Sequence 5'–3' | Tm (°C) | Reference |
---|---|---|---|---|
ITS | ITS4 | TCCTCCGCTTATTGATATGC | 55.0 |
|
ITS5 | GGAAGTAAA AGTCGTAACAAGG | |||
ndhJ-trnF | ndhJ | ATGCCYGAAAGTTGGATAGG | 54.2 |
|
tabE | GGTTCAAGTCCCTCTATCCC |
|
||
psbD-trnT | psbD | CTCCGTARCCAGTCATCCATA | 54.8 |
|
trnTGGU | CCCTTTTAACTCAGTGGTAG | |||
psbJ-petA | psbJ | ATAGGTACTGTARCYGGTATT | 54.5 |
|
petA | AACARTTYGARAAGGTTCAATT |
We downloaded an extensive dataset of ITS, cpDNA regions and chloroplast genomes from NCBI to better perform the phylogenetic analysis and confirm the systematic position of this new species. We downloaded 107 ITS sequences from 43 Allium species, and 69 cpDNA regions and 55 chloroplast genomes from 10 and 37 Allium species, respectively. To conduct the phylogenetic analysis using the three cpDNA regions, we extracted each cpDNA region from the 56 chloroplast genomes. The detailed Genbank accession information of all sequences is provided in Suppl. material
Newly sequenced ITS and cpDNA regions were assembled using the SeqMan software (
China. Henan Province: Songxian County, Longchiman mountains, 111°59'24.31"E, 33°41'25.61"N, 1347 m alt., 04 September 2021, Anonymous, XDF20210904 (Holotype:
Allium heterophyllum resembles A. dumebuchum due to its rhomboid scape in cross-section. However, it is clearly distinguished from A. dumebuchum in perianth (white to light purple vs. light purple), leaves (not tortuous and not flesh vs. slight tortuous and flesh), the cross-section of leaves (two types vs. one type), flowers’ density (loose inflorescence vs. many-flowered) (Fig.
The diagnostic morphological characters of Allium heterophyllum and related species.
Character | A. heterophyllum | A. dumebuchum | A. spirale | A. spurium | A. minus | A. senescens | A. nutans | |
---|---|---|---|---|---|---|---|---|
Bulb | growth pattern | solitary, paired or clustered | clustered | clustered | solitary or paired | clustered | solitary or paired | solitary or paired |
shape | conical to ovate-cylindric | conical to cylindric | conical to cylindric | cylindric to conical-cylindric | conical to cylindric | conical to ovate-cylindric | narrowly cylindric to subconical | |
diameter (mm) | 5.0–15.0 | 9.6–15.0 | 5.0–15.0 | 5.0–15.0 | 4.3–8.6 | 10.0–20.0 | 15.0–20.0 | |
Rhizome | growth pattern | oblique to horizontal | oblique to horizontal | horizontal | horizontal | oblique | horizontal | horizontal or oblique and stout |
Leaf sheath | exposed or buried | exposed | exposed | buried | buried | exposed | exposed | exposed |
Leaf blade | shape | linear, solid, not fleshy, canaliculated with one bulge in the back or flat with irregularly one or two-edged margin | ascending, slightly tortuous, linear, flat and solid in cross-section, flesh, apex obtuse to rounded | linear, spirally tortuous, flat, main veins and margins minutely scabrous-denticulate, rarely smooth, fleshy, apex obtuse | narrowly linear, straight, flat to convex-flat, fleshy, margin minutely scabrous, apex acute to gradually attenuate, truncate | ascending, spirally tortuous, flat, fleshy, linear, solid, fleshy, obtuse to rounded at apex | spirally arranged, broadly linear, fleshy, sometimes slightly falcate | broadly linear, subfalcate, flat, thick, fleshy, smooth, apex obtuse |
length (cm) | 15–45.0 | 19.5–38.0 | 20.0–45.0 | 15–30.0 | 11.4–24.5 | 23.0–45.0 | 30.0–55.0 | |
width (mm) | 1.5–4.0 | 3.8–13.0 | 4.0–10.0 | 1.5–4.0 | 2.8–4.5 | 5.0–15.0 | 6.0–15.0 | |
Umbel | shape | hemispheric, loose | subglobose, many-flowered | hemispheric to subglobose, many-flowered. | laxly hemispheric, many-flowered. | hemispheric | hemispheric to globose, many-flowered | globose, densely many-flowered |
Scape | cross-section | rhomboid | rhomboid | flattened-winged | rhomboid to subterete | subterete | subterete | 2-angled, narrowly 2-winged |
length (cm) | 25.0–45.0 | 23.4–49.0 | 33.0–65.0 | 10.0–40.0 | 11.7–20.5 | 25.8–70.0 | 30.0–60.0 | |
diameter (mm) | 1.5–2.5 | 2.5–5.6 | 4.0–5.1 | 1.5–2.5 | 1.5–1.6 | 3.0–5.5 | 3.5–6.0 | |
Pedicel | length (mm) | 10.0–15.0 | 9.8–11.2 | 6.0–12.4 | 7.6–11.1 | 8.7–11.1 | 8.0–13.0 | 9.0–15.5 |
Spathe | 1-valved, persistent and inconspicuous | unknown | 2-valved, persistent | 2-valved, usually caducous | unknown | 2-valved, persistent | 2-valved, persistent | |
Perianth | color | white to light purple | light purple | reddish purple | strong purple or pale purple | pale purple | pale purple | pale red to pale purple |
Inner tepal | shape | elliptical | elliptical to ovate-elliptical | ovate-elliptical | ovate-elliptical | elliptical | elliptical | ovate |
length (mm) | 4.0–6.0 | 5.2–7.2 | 4.0–6.8 | 3.9–6.3 | 4.0–4.8 | 4.3–6.4 | 5.0–6.5 | |
width (mm) | 2.2–2.5 | 3.4–4.5 | 2.0–4.2 | 2.2–3.4 | 1.2–1.9 | 1.8–2.9 | 2.2–3.0 | |
Outer tepal | shape | ovate-elliptical | ovate-elliptical | ovate-elliptical | ovate-elliptical | ovate-oblong | ovate-elliptical | narrowly ovate |
length (mm) | 3.0–4.0 | 4.8–6.1 | 3.1–5.0 | 2.9–5.2 | 3.7–4.6 | 3.1–5.2 | 4.5–5.5 | |
width (mm) | 1.6–1.9 | 2.1–3.7 | 1.3–3.0 | 1.1–2.3 | 1.1–1.7 | 1.1–2.5 | 1.5–2.0 | |
Filament | exsertion | exserted | exserted | exserted | exserted | included | exserted | exserted |
length (mm) | 6.3–7.5 | 6.2–8.4 | 5.3–8.8 | 5.0–7.0 | 3.2–4.4 | 4.6–6.9 | 6.5–8.5 | |
Base of inner filament | shape | narrowly triangular | narrowly triangular | subulate | subulate | broadened in the lower half | broadened in the lower half | broadened in the lower half, 1-toothed on each side |
Anther | color | purple grey | purple | purple | yellow | reddish | black or yellowish-brown | yellow |
length (mm) | 1.8–2.3 | 2.2–2.5 | 1.7–2.2 | 1.7–2.0 | 1.3–1.4 | 1.5–2.0 | 1.8–2.3 | |
width (mm) | 0.9–1.4 | 0.9–1.1 | 0.7–1.0 | 0.6–0.8 | 0.6–0.8 | 0.5–0.8 | 0.6–0.9 | |
Ovary | shape | obovoid | obovoid | broadly ovoid | ovoid | obovoid | obovoid | oblong-globose |
Flowering season | late Aug. to Sep. | late Sep. to Oct. | Aug. to Sep. | Jul. to Aug. | May to Jul. | Jul. to Aug. | Jun. to Aug. | |
Chromosome number (2n) | 2n = 16 | 2n = 32 | 2n = 16, 32 | 2n = 16, 32 | 2n = 16 | 2n = 32 | 2n = 16, 17, 24, 28, 32, 44, 48, 56, 64, 72 |
Morphological characters of Allium heterophyllum A, D single flower with light purple or white color B, E outer (left) and inner (right) tepals C, F inner (top) and outer (bottom) tepals and stamen G stamen and trait at the base H ovary I cross-section of ovary showing the carpels J–L the cross-section of leaf showing the blade characters M cross-section of rhomboid scapes N seeds’ characters.
Perennial herbs, bulbs solitary, paired or clustered, ovate-cylindric or conical, 5.0–15 mm in diameter, tunics membranous, white, attached to a horizontal or oblique rhizome, 5.0–20.0 mm in diameter, surface usually blackish gray. Leaves linear, 5.0–10.0, solid in cross-section, 1.0–30.0 (–45.0) cm long and 1.5–4.0 mm wide, usually shorter than scape, sometimes equal to the length of scape, exposed sheaths in 1/7; cross-section of leaves exposed two types of morphologies, canaliculated with one bulge in the back or flat with irregularly one or two-edged margin; the leaves’ shape differences are most obvious in flower and fruit periods but not obvious in young leaves. Scapes rhomboid, solid in cross-section, 25.0–45.0 cm long, and 15.0–25.0 mm in diameter. Spathe 1-valved, persistent and inconspicuous; inflorescence umbellate hemispheric, loose. Pedicels equal, 10.0–15.0 mm; perianth white to light purple, inner tepals 4.0–6.0 mm, longer than outer ones, elliptical, apex obtuse; outer tepals 3.0–4.0 mm, ovate-elliptical. Filaments equal and exserted, white to light purple in the upper part, 1.5 × as long as perianth segments and connate at the base of the perianth. Outer one subulate, inner filaments narrowly triangular; anthers elliptical, purple-grey. Ovary obovoid, trigonous, white to light purple, without concave nectaries. 3 carpel and ovules 2 per locule, style exserted, stigma punctiform. Capsule obovate; seeds black, rhomboidal, 1.5–2.0 mm wide and 2.5–3.0 mm long (Fig.
The new species epithet “heterophyllum” is based on the unique leaves’ characters, its leaves exposed two types of morphologies, canaliculated with one bulge in the back or flat with irregularly one or two-edged margin, and the differences in the leaves are most obvious in flowering and fruit periods. (Fig.
Through two field investigations, A. heterophyllum was flowering from late August to September and fruiting from late September to October.
Currently, A. heterophyllum is only known from the type population in Longchiman Mountains in Songxian County, Henan, China. This species grows on the open slope of rock by the river with a small amount of soil attached, sometimes rooting in crevices, holes or steps of the rock face at an elevation from 1250 m to 1400 m.
Yi Ye Jiu (异叶韭).
The latest study suggested that as many as one-third of the species could face extinction within the next 50 years due to biodiversity loss resulting from climate change (
Total ITS alignments were 703 bp in length with 446 variable sites (63.44%) and 421 parsimony-informative characters (PICs; 59.89%). Alignments of the three cpDNA regions possessed 3708 bp with 707 variable sites (19.07%) and 432 PICs (11.65%). The phylogenetic tree from ITS data was consistent with the cpDNA data set tree, in which the subgenus Rhizirideum is monophyletic and subgenera Allium, Cepa, and Polyprason are polyphyletic (Figs
Phylogenetic relationships inferred from ITS. Trees constructed with maximum likelihood (ML) and Bayesian inference (BI). Support values reported above the branches are bootstrap values of ML and posterior probability of BI. * = maximum support in the two analyses. Samples of Allium sect. Rhizirideum are in rose red and the sequences of Allium heterophyllum are in red and markered with the star.
Phylogenetic relationships inferred from three cpDNA alignments. Trees constructed with maximum likelihood (ML) and Bayesian inference (BI). Support values reported above the branches are bootstrap values of ML and posterior probability of BI. * = maximum support in the two analyses. Branches of Allium sect. Rhizirideum are in rose red and the samples of Allium heterophyllum are in red and markered with the star.
Our phylogenetic results detected a similar topology to previous studies (
Through our field investigation, only one population with approximately 120 individuals of this species was discovered in the Longchiman Mountains. Given the development of tourism in this region, it is possible that this population may be threatened by pedestrian traffic, pollution, infrastructure development and other threatening processes associated with tourism. Therefore, this species is preliminarily considered as Near Threatened (NT) according to the IUCN Red List Categories and Criteria (
We thank Dr. J. B. Tan, CK. Liu, and T. Ren for their help in preparing this paper. This work was supported by the National Natural Science Foundation of China (Grant Nos. 32100180, 32170209, 31872647), the Fundamental Research Funds for the Central Universities (20826041E4158), the China Postdoctoral Science Foundation (2020M683303), and the Chinese Ministry of Science and Technology through the National Science and Technology Infrastructure Platform Project (Grant No. 2005DKA21403-JK).
Table S1
Data type: Sequence data accession NCBI numbers.
Explanation note: List of species accession NCBI numbers in this study.