Research Article
Print
Research Article
Dipteris shenzhenensis, a new endangered species of Dipteridaceae from Shenzhen, southern China
expand article infoZuo-Ying Wei‡§, Yu-Feng Gu|§, Zeng-Qiang Xia§, Li-Jun Chen§, Ting Wang#§, Shou-Zhou Zhang¤, Guo-Hua Zhao¤, Jian-Bing Chen§, Jian-Guo Cao«, Yue-Hong Yan§
‡ Shanghai Normal University, Shanghai, China
§ Key Laboratory of National Forestry and Grassland Administration for Orchid Conservation and Utilization, The National Orchid Conservation Center of China and The Orchid Conservation and Research Center of Shenzhen, Shenzhen, China
| Harbin Normal University, Harbin, China
¶ Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, Shanghai, China
# Southwest Forestry University, Shenzhen, China
¤ Fairy Lake Botanical Garden, Shenzhen & Chinese Academy of Sciences, Shenzhen, China
« Shanghai Normal University,, Shanghai, China

Corresponding author: Yue-Hong Yan ( yhyan@sibs.ac.cn )

Academic editor: Yasen Mutafchiev
© 2021 Zuo-Ying Wei, Yu-Feng Gu, Zeng-Qiang Xia, Li-Jun Chen, Ting Wang, Shou-Zhou Zhang, Guo-Hua Zhao, Jian-Bing Chen, Jian-Guo Cao, Yue-Hong Yan.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Wei Z-Y, Gu Y-F, Xia Z-Q, Chen L-J, Wang T, Zhang S-Z, Zhao G-H, Chen J-B, Cao J-G, Yan Y-H (2021) Dipteris shenzhenensis, a new species of Dipteridaceae connected with broad wings from Shenzhen, southern China. PhytoKeys 186: 111-120. https://doi.org/10.3897/phytokeys.186.73739
Open Access

Abstract

Dipteris shenzhenensis, a new species of ferns from Shenzhen, Guangdong, southern China, is identified and described. It closely resembles D. chinensis but possesses several unique traits, such as long rhizome scales, castaneous stipe, and abaxially pale fronds with two fan-shaped fronds connected by a broad wing. Molecular evidence showed that D. shenzhenensis is allied to D. conjugata, whereas it has morphologically significant differences (P < 0.05) on the basis of quantitative trait statistical analysis. Overall, the morphological evidence, taken together with the result of cpDNA indicated that D. shenzhenensis is a distinct species.

Keywords

fern, Gleicheniales, morphology, phylogeny, quantity traits, taxonomy

Introduction

Dipteris Reinw. is one of two genera in Dipteridaceae (Zhang et al. 2013; PPG I 2016), and is considered as an early-diverging leptosporangiate fern lineage related to the Gleicheniaceae (Schuettpelz and Pryer 2007; Lehtonen 2011). The genus has rare components consisting of about eight species, and is restricted to Indo-Malaysian Islands, including north-eastern India, southern China, and from the southern Ryukyus to northeast Queensland (Australia) and Fiji (Kramer 1990; Zhou et al. 2016; Choo and Escapa 2018; Zhang et al. 2013). The morphology of Dipteris is characterized by having long creeping rhizomes and fan-shaped fronds possessing elaborately anastomosing veins with free veinlets in the areoles (Bomfleur and Kerp 2010; Tidwell and Ash 1994).

In August 2020, during botanical research on Mt. Qiniangshan in Shenzhen, Guangdong, southern China, a unique species of Dipteris was documented on rocks in evergreen broad-leaf forest. The species is so similar to D. chinensis Christ that it has always been interpreted as the latter (Yan 2017). Upon closer carefully specimen identification and comparison with other species in Dipteris, we found that this unknown species possesses several unique characteristics, the most striking of which is awfully long rhizome scales. Furthermore, we constructed the molecular phylogeny of Dipteris to obtain a phylogenetic insight into the species. The morphological evidence taken together with the result of cpDNA validated it as a new species.

Materials and methods

Morphological analyses

The features of rhizome scales were obtained using a Leica M205A dissecting microscope. Morphology of spores was observed with Phenom Pro scanning electron microscope after being sputter-coated with gold. Measurements were made from mature and intact specimens. For length and width of lobes, each specimen was measured six times using ImageJ software (Collins 2007), followed by taking an average. All images of specimens were provided by the National Specimen Information Infrastructure (http://www.nsii.org.cn), Global Biodiversity Information Facility (https://www.gbif.org/), and JSTOR (https://plants.jstor.org/). Voucher specimens were deposited in the National Orchid Conservation Center of China (NOCC) and Shenzhen Fairy Lake Botanical Garden Herbarium (SZG).

Phylogenetic analyses

Ten samples, representing five species were used in this study. Apart from the sequences of Dipteris conjugata Reinw. (Metzgar et al. 2008) and the outgroup Cheiropleuria integrifolia (D. C. Eaton ex Hook.) M. Kato, Y. Yatabe, Sahashi & N. Murak. (Schuettpelz and Pryer 2007) were downloaded from GenBank, all other sequences were newly generated (Table S1). Five chloroplast DNA (cpDNA) regions (rbcL, atpA, rps4, rbcL-accD and trnG-trnR) were extracted, amplified and sequenced following Wei et al. (2021). Primers used for polymerase chain reaction (PCR) amplification and sequencing are shown in Table 1. All sequences newly generated in this study were deposited in GenBank (see Table S1 for accession numbers). The cpDNA sequences were assembled and edited using SeqMan v.7.1.0 (DNASTAR, USA), then aligned using MEGA v.7.0 (Kumar et al. 2016). Alignments of five genes were concatenated using PhyloSuite (Zhang et al. 2020), and best nucleotide substitution model (Table 2) was used on the basis of Akaike Information Criterion with PartitionFinder2 (Lanfear et al. 2017) integrated into PhyloSuite. Bayesian analysis was constructed using MrBayes v.3.2.6 (Ronquist et al. 2012) with four Markov chains for 1,000,000 generations, sampling every 100 generations. Standard deviation of split frequencies was controlled within 0.01 to ensure the convergence of the independent runs. The majority-rule consensus tree and estimation of the posterior probabilities (PP) were performed with the first 25% of samples discarded as burn-in.

Table 1.
Download as
CSV
XLSX

List of primers used in the study.

Primer Sequence Reference
rbcL ESRBCL1F ATGTCACCACAAACGGAGACTAAAGC Schuettpelz and Pryer (2007)
ESRBCL1361R TCAGGACTCCACTTACTAGCTTCACG Schuettpelz and Pryer (2007)
atpA ESATPF412F GARCARGTTCGACAGCAAGT Schuettpelz et al. (2006)
ESTRNR46F GTATAGGTTCRARTCCTATTGGACG Schuettpelz et al. (2006)
rps4 RPS5* ATGTCCCGTTATCGAGGACCT Nadot et al. (1994)
TRNS* TACCGAGGGTTCGAATC Souza-Chies et al. (1997)
trnG-trnR TRNG1Fa GCGGGTATAGTTTAGTGGTAA Korall et al. (2007)
TRNR22Ra CTATCCATTAGACGATGGACG Korall et al. (2007)
rbcL-accD RBCL1187Fa GGAACYTTGGGACATCCTTGG Korall et al. (2007)
ACCD816Ra CCATGATCGAATAAAGATTCAGC Ebihara et al. (2003)
Table 2.
Download as
CSV
XLSX

Best nucleotide substitution model in phylogenetic analyses.

Partition names MrBayes Sites
atpA, trnG-trnR GTR 2 098
rbcL, rps4 GTR+G 1 279
rbcL-accD GTR+I+G 806

Results and discussion

Morphological comparison

Dipteris shenzhenensis has been confused with D. conjugata and D. chinensis because of similar gross morphology. This is especially true of dried herbarium specimens. Most specimens of D. shenzhenensis were formerly identified as D. chinensis in herbaria because of the presence in similar fronds morphology. We studied most online specimens of these three species and conducted quantitative trait statistical analysis. The result showed that D. conjugata displayed significant differences compared to D. shenzhenensis and D. chinensis in the length of lobes (LL) (P < 0.0001), the width of lobes (WL) (P < 0.0001), and the number of lobes for each half of the fan-shaped fronds (NL) (P < 0.0001) (Fig. 1). Dipteris shenzhenensis and D. chinensis were indistinguishable from the WL (P > 0.05), with the significant difference being in the LL (P < 0.0001) and the NL (P < 0.05) (Fig. 1). The former was also readily distinguished from the latter by having stiffer rhizome scales and castaneous stipe, as well as being pale abaxially (Fig. 2, Table 3). Micromorphological comparison indicated that the rhizome scale length of D. shenzhenensis was twice that of D. chinensis (Fig. 2). Most notably, the two fan-shaped fronds of D. shenzhenensis were connected by broad wings at the base in contrast to these of D. conjugata, D. chinensis, and other species in Dipteris (Figs 2 and 3).

Figure 1. 

Boxplot (median and interquartile values) for the length of lobes (left), the width of lobes (center), and the number of lobes of each half of the fan-shaped fronds (right) amongst Dipteris conjugata, D. shenzhenensis and D. chinensis. Significant differences between species are represented with * (P < 0.05), ** (P < 0.001), and *** (P < 0.0001).

Table 3.
Download as
CSV
XLSX

Comparisons of morphological characters and elevational range of Dipteris shenzhenensis and D. chinensis.

Character D. shenzhenensis D. chinensis
Rhizome Long and creeping Creeping
Rhizome scales Dark brown to black, 6.8–8.0 × 0.06–0.27 mm Brown, 3.74–4.00 × 0.04–0.26 mm
Fronds Abaxially pale; base with broad wings Abaxially green; base without wings
Lobes 4–6 × 14.5–18.0 cm 4–8 × 17–23 cm
Stipe Castaneous, 40–85 cm Stramineous to brown, 25–50 cm
Spores 18.5–19 × 37.5–39 μm 21.5– 25.5× 32.5–39 μm
Elevation 70–200 m 500–2100 m

Phylogenetic analyses

To further determine the relationships among the three species, we conducted Bayesian analysis using the five chloroplast gene regions (rbcL, atpA, rps4, rbcL-accD, and trnG-trnR). With the Cheiropleuria integrifolia as outgroup, the phylogram showed that Dipteris can be classified into four well-supported clades. Dipteris shenzhenensis was typically well supported as monophyletic and strongly supported as sister to D. conjugata (PP = 1.0) (Fig. 4). Although D. shenzhenensis has been misidentified as D. chinensis, the relationship between the two species was not close. In addition, because there were missing data form many samples, the several clades showed a relatively low resolution in Bayesian phylogenetic analyses. We will, in future, use more molecular markers or utilize high-throughput sequencing to obtain a better topology with resolution.

Overall, based on the above morphological comparison and molecular phylogenetic analyses, D. shenzhenensis is clearly different from D. conjugata and D. chinensis. We therefore here describe D. shenzhenensis as a new species.

Taxonomic treatment

Dipteris shenzhenensis Y.H.Yan & Z.Y.Wei, sp. nov.

urn:lsid:ipni.org:names:77234195-1
Figs 2 and 3

Diagnosis

The new species is similar to D. chinensis, but differs in rhizome scales being longer (6.8–8.0 mm vs. 3.74–4.00 mm), in the base and color of fronds (base with broad wings, abaxially pale vs. base without wings, abaxially green), and in stipe color (castaneous vs. stramineous to brown).

Type

China. Guangdong Province: Shenzhen City, Mt. Qiniangshan, elev. ca. 82 m, 16 August 2020, Y. H. Yan et al. YYH15638 (holotype: SZG!; isotype: NOCC!)

Description

Plants. terrestrial on rocks, 0.5–1.0 m tall. Rhizome. long-creeping, ca. 1 cm in diam., densely scaly. Rhizome scales. spreading, dark brown to black, stiff, margin almost entire, 6.8–8.0 × 0.09–0.27 mm, lanceolate, apex long acuminate, acumen up to 2–3 mm long; Stipe. glabrous except at the very base, castaneous, 30–85 cm. Fronds. slightly funnel-shaped, divided into 2 fan-shaped fronds, each half deeply divided into 4 to 5 unequal lobes, lobes shallowly divided one or more times, with 8–10 ultimate lobes in each half of lamina, abaxially glabrous and pale; base with broad wings; venation reticulate, visible on both surfaces, prominent abaxially. Lobes. margins serrate, apices acute, 4.5–12.0 × 10.5–17.0 cm, reticulated venation network. Spores. spreading, monolete, 18.5–19.0 × 37.5–39.0 μm, glabrous.

Figure 2. 

Morphological features of Dipteris shenzhenensis Y.H.Yan & Z.Y.Wei (A–E) and D. chinensis (F–J). A fan-shaped frond of D. shenzhenensis B the frond base with broad wing of D. shenzhenensis C rhizome of D. shenzhenensis D spore of D. shenzhenensis E rhizome scale of D. shenzhenensis F fan-shaped frond of D. chinensis G the frond base without wing of D. chinensis H rhizome of D. chinensis I spore of D. chinensis J rhizome scale of D. chinensis.

Distribution and habitat

So far only known from Shenzhen City, Guangdong Province, southern China. It is distributed in Mt. Qiniangshan, growing on rocks at elevation of 70–200 m in evergreen broad-leaf forest.

Figure 3. 

Dipteris shenzhenensis Y.H.Yan & Z.Y.Wei A habit B details of a lamina showing the venation and the distribution of sori C rhizome scale showing the profile and length (drawn by Zuo-Ying Wei & Li-Jun Chen, based on the type material at SZG).

Chinese name

Shen-zhen-shuang-shan-jue (深圳双扇蕨).

Figure 4. 

The phylogenetic tree inferred by the Bayesian inference with posterior probabilities above the branches.

Etymology

Dipteris shenzhenensis was discovered in the City of Shenzhen located in Guangdong Province, southern China. The specific epithet, therefore, is from this city name.

Conservation status

Dipteris shenzhenensis is currently found in only one location in Mt. Qiniangshan, Shenzhen City, Guangdong Province, southern China. The predicted Area of Occupancy (AOO) for the species is no more than 5,000 m2. This species prefers to grow in low and opening mountain areas and is very likely to experience human disturbance. Over the past 20 years, the authors have observed that D. shenzhenensis showed signs of decline with the recovery of macrophanerophytes in Mt. Qiniangshan. Following the International Union for Conservation of Nature (IUCN) Categories and Criteria (IUCN 2019), we regard the newly discovered D. shenzhenensis as of Critically Endangered (CR) (B1a; B2ab).

Additional specimens examined

China. Guangdong Province, Shenzhen City, Mt. Qiniangshan, elev. ca. 90 m, 16 August 2020, Y. H. Yan et al. YYH15637 (NOCC!); loc. cit., elev. ca. 200 m, 27 December 2003, Y. H. Yan 1937 (HUST!); loc. cit., elev. ca. 150 m, 8 November 2002, Y. H. Yan 885 (HUST!); loc. cit., 17 August 2002, S. Z. Zhang et al. 011036-A1 (SZG, photo!); loc. cit., elev. ca. 75.38 m, 18 November 2015, L. Jiang & Y. P. Chen JL00328 (KUN, photo!); loc. cit., elev. ca. 70 m, 22 February 2003, S. Z. Zhang et al. 012037-A (SZG, photo!); loc. cit., elev. ca. 70 m, 22 February 2003, S. Z. Zhang et al. 012037-B (SZG, photo!); loc. cit., 31 March 2000, F. W. Xing & Y. X. Zhang 12374 (IBSC, photo!). s. coll. 0685742 (IBSC, photo!)

Acknowledgements

We thank Ming-Xu Zhao, Qiang Luo, Bing Liu, Jian-Fei Ye, Hong-Qiang Xiao and Putao Expedition Team, including Jin-Xiao Hua, Zhi-Duan Chen, Yu-Min Shui, Sheng-Xiang Yu and Bing Liu for sharing materials. We are grateful to Xi-Le Zhou for providing the photos of Dipteris chinensis. We thank Ting Xu and Fairy Lake Botanical Garden, Shenzhen & Chinese Academy of Sciences for providing us with the scanning electron microscope, and the staff of Shenzhen Dapeng Peninsula National Geopark for their assistance in our field investigations. This study was supported by the Strategic Priority Research Program of the Chinese Academy of Sciences (No. XDA19050404) and the National Natural Science Foundation of China (Grant No. 32170216).

References

  • Bomfleur B, Kerp H (2010) The first record of the dipterid fern leaf Clathropteris Brongniart from Antarctica and its relation to Polyphacelus stormensis Yao, Taylor et Taylor nov emend. Review of Palaeobotany and Palynology 160(3–4): 143–153. https://doi.org/10.1016/j.revpalbo.2010.02.003
  • Choo TYS, Escapa IH (2018) Assessing the evolutionary history of the fern family Dipteridaceae (Gleicheniales) by incorporating both extant and extinct members in a combined phylogenetic study. American Journal of Botany 105(8): 1–14. https://doi.org/10.1002/ajb2.1121
  • Ebihara AK, Iwatsuki K, Ohsawa TA, Ito M (2003) Hymenophyllum paniense (Hymenophyllaceae), a new species of filmy fern from New Caledonia. Systematic Botany 28: 228–235. https://doi.org/10.1043/0363-6445-28.2.228
  • IUCN (2019) Guidelines for using the IUCN red List Categories and Criteria. Version 14. Prepared by the Standards and Petitions Subcommittee. Available from: http://www.iucnredlist.org/documents/ RedListGuidelines.pdf [accessed: 6 January 2020]
  • Korall P, Conant DS, Metzgar JS, Schneider H, Pryer KM (2007) A molecular phylogeny of scaly tree ferns (Cyatheaceae). American Journal of Botany 94(5): 873–886. https://doi.org/10.3732/ajb.94.5.873
  • Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870–1874. https://doi.org/10.1093/molbev/msw054
  • Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2017) PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34: 772–773. https://doi.org/10.1093/molbev/msw260
  • Metzgar JS, Skog JE, Zimmer EA, Pryer KM (2008) The paraphyly of Osmunda is confirmed by phylogenetic analyses of seven plastid loci. Systematic Botany 33(1): 31–36. https://doi.org/10.1600/036364408783887528
  • Nadot S, Bajon R, Lejeune B (1994) The chloroplast gene rps4 as a tool for the study of Poaceae phylogeny. Plant Systematics and Evolution 191(1–2): 27–38. https://doi.org/10.1007/BF00985340
  • PPG I (2016) A community-derived classification for extant lycophytes and ferns. Journal of Systematics and Evolution 54(6): 563–603. https://doi.org/10.1111/jse.12229
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Schuettpelz E, Pryer KM (2007) Fern phylogeny inferred from 400 leptosporangiate species and three plastid genes. Taxon 56(4): 1037–1050. https://doi.org/10.2307/25065903
  • Schuettpelz E, Korall P, Pryer KM (2006) Plastid atpA data provide improved support for deep relationships among ferns. Taxon 55(4): 897–906. https://doi.org/10.2307/25065684
  • Souza-Chies TT, Bittar G, Nadot S, Carter L, Besin E, Lejeune B (1997) Phylogenetic analysis of Iridaceae with parsimony and distance methods using the plastid gene rps4. Plant Systematics and Evolution 204(1–2): 109–123. https://doi.org/10.1007/BF00982535
  • Yan YH (2017) Dipteridaceae. In: Wang GB (Eds) Flora of Shenzhen. vol. 1. China Forestry Publishing House, Beijing, 70.
  • Zhang XC, Kato M, Nooteboom HP (2013) Dipteris Reinw. In: WU ZY, Raven PH, Hong DY (Eds) Flora of China: Vol. 2/3 (Gleicheniaceae). Science Press, Beijing and Missouri Botanical Garden Press.
  • Zhang D, Gao FL, Jakovlic I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 20(1): 348–355. https://doi.org/10.1111/1755-0998.13096
  • Zhou N, Wang YD, Li LQ, Zhang XQ (2016) Diversity variation and tempo-spatial distributions of the Dipteridaceae ferns in the Mesozoic of China. Palaeoworld 25(2): 263–286. https://doi.org/10.1016/j.palwor.2015.11.008

Supplementary materials

Supplementary material 1 

Table S1. List of species and GenBank accession numbers used in the present study

Zuo-Ying Wei, Yu-Feng Gu, Zeng-Qiang Xia, Li-Jun Chen, Ting Wang, Shou-Zhou Zhang, Guo-Hua Zhao, Jian-Bing Chen, Jian-Guo Cao, Yue-Hong Yan

Data type: molecular data

Explanation note: Dash (—) indicates unavailable data.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (16.22 kb)
Supplementary material 2 

Table S2. Specimen information used for morphological comparison

Zuo-Ying Wei, Yu-Feng Gu, Zeng-Qiang Xia, Li-Jun Chen, Ting Wang, Shou-Zhou Zhang, Guo-Hua Zhao, Jian-Bing Chen, Jian-Guo Cao, Yue-Hong Yan

Data type: species data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (18.46 kb)
login to comment