Research Article
Print
Research Article
Efficient DNA barcode regions for classifying Piper species (Piperaceae)
expand article infoArunrat Chaveerach, Tawatchai Tanee§, Arisa Sanubol, Pansa Monkheang, Runglawan Sudmoon
‡ Khon Kaen University, Khon Kaen, Thailand
§ Khon Kaen University (Khon Kaen) and Mahasarakham University, Mahasarakham, Thailand
Open Access

Abstract

Piper species are used for spices, in traditional and processed forms of medicines, in cosmetic compounds, in cultural activities and insecticides. Here barcode analysis was performed for identification of plant parts, young plants and modified forms of plants. Thirty-six Piper species were collected and the three barcode regions, matK, rbcL and psbA-trnH spacer, were amplified, sequenced and aligned to determine their genetic distances. For intraspecific genetic distances, the most effective values for the species identification ranged from no difference to very low distance values. However, P. betle had the highest values at 0.386 for the matK region. This finding may be due to P. betle being an economic and cultivated species, and thus is supported with growth factors, which may have affected its genetic distance. The interspecific genetic distances that were most effective for identification of different species were from the matK region and ranged from a low of 0.002 in 27 paired species to a high of 0.486. Eight species pairs, P. kraense and P. dominantinervium, P. magnibaccum and P. kraense, P. phuwuaense and P. dominantinervium, P. phuwuaense and P. kraense, P. pilobracteatum and P. dominantinervium, P. pilobracteatum and P. kraense, P. pilobracteatum and P. phuwuaense and P. sylvestre and P. polysyphonum, that presented a genetic distance of 0.000 and were identified by independently using each of the other two regions. Concisely, these three barcode regions are powerful for further efficient identification of the 36 Piper species.

Keywords

DNA barcoding, matK gene, Piper species, psbA-trnH spacer, rbcL gene

Introduction

Plants in the genus Piper have been used since prehistoric times for a variety of human activities. They are used as spices, in traditional and processed forms of medicines, in cosmetic compounds, in cultural activities and as insecticides (Chaveerach et al. 2006a, Scott et al. 2008, Fan et al. 2011). Piper betle, the betel plant, is one of the most important and well-known species of the genus. It contains important chemical substances, such as chavicol, cineol and eugenol, used in essential oils, medicines and insecticides (Yusoff et al. 2005, Misra et al. 2009). Eugenol has been reported as having anti-oxidant and anti-inflammatory properties (Misra et al. 2009). Although the betel plant is of great economic importance, it is challenging to cultivate. The main problem is foot and leaf rot, which is caused by the fungus Phytophthora parasitica Dast. In addition, the plant is subject to leaf spot, which is caused by bacteria (Silayoi et al. 1985, Banka and Teo 2000). Investigations of the genus Piper in Thailand (Chaveerach et al. 2008, 2009) have found that among the 43 Piper species, some produce a betel-like scent. Of these, all are wild species and hardy, producing numerous branches and leaves. They are tolerant and resistant to disease. Some produce a stronger scent than betel. Therefore, these species might be equally or more economically beneficial than the betel plant. The assured advantage is that there would be more choices of plants for use (Sanubol et al. 2014). Medicinal plants have been used in natural and modified forms. The modified forms such as dried sliced plant parts, powder and capsules, are difficult to recognize by physical features. Therefore, reliable identification methods for these plant forms should be developed. DNA barcoding is the most reliable and applicable method for identification. The method was developed in 2003 (Hebert et al. 2003). It principally uses short DNA sequences from appropriate genome regions for the identification of organisms. The CO1 and 16s rDNA regions have been successfully used for most animals. For example, Hebert et al. (2004) used the mitochondrially encoded cytochrome c oxidase I (MT-CO1) to discriminate between bird species. Zhang and Hanner (2012) used sequences of MT-CO1, 16s RNA, MT-CYB and RNA 18s in 242 species of fish and in 11 Epinephelus species.

For plants, however, it is more of a challenge. Currently, several research groups are seeking a suitable genome region, and this effort has led to the identification of appropriate regions for DNA barcoding in some plant groups, such as the matK gene (Siripiyasing et al. 2012, Tanee et al. 2012), the rbcL gene (Tanee et al. 2012, Kwanda et al. 2013), the psbA-trnH spacer region (Chaveerach et al. 2011).

The standard barcodes used for most investigations of plants are the three plastid barcodes, which include matK gene, rbcL gene and psbA-trnH spacer, and one nuclear (ITS) regions identified by the CBOL Plant Working Group (2009), Chaveerach et al. (2011), Hollingsworth et al. (2011) and Monkheang et al. (2011). With the importance of Piper species as economically valued plants worldwide and with the plant parts of many species being used, such as the trunk, leaves and fruits, as well as young plants and processed plant materials in the forms of powder and slices, identifying the species used is paramount to verify the authenticity of such goods. Therefore, these products should have a specific marker that identifies a species using barcode for each species.

The aim of this research was to construct barcodes for Piper species in Thailand using matK, rbcL and the psbA-trnH spacer regions, as these species are important medicinal plants that have not been fully explored for barcode identification. Here we initiate the development of reference barcodes for plant parts, young plants and plant products.

Materials and methods

Plant materials

Species and sites of Piper recently reported in Thailand (Chaveerach et al. 2006a, 2006b, 2007, 2008, Sudmoon et al. 2011) were collected and carefully identified followed the literatures. Leaf samples were kept on ice, transferred to the laboratory, and then stored at -20 °C until further use.

DNA extraction

Whole genomic DNA was extracted using a Plant Genomic DNA Extraction Kit (RBC Bioscience) following the kit protocols.

Amplification of barcode fragments

Polymerase chain reaction (PCR) analyses were performed with primer pairs (5'–3') ATCCATCTGGAAATCTTAGTTC and GTTCTAGCACAAGAAAGTCG (CBOL Plant Working Group 2009) for the matK gene, GTCACCACAAACAGAGACTAAAGC and GTAAAATCAAGTCCACCRCG (CBOL Plant Working Group 2009) for the rbcL gene, and GTTATGCATGAACGTAATGCTC and CGCGCATGGTGGATTCACAATCC (Hollingsworth et al. 2011) for the psbA-trnH spacer region. The reaction mixture (30 µl) consisted of 1× GoTaq Green Master Mix (Promega), 0.5 µM primers, and 30 ng of DNA template. The amplification profile included pre-denaturation at 94 °C for 1 min, 35 cycles of denaturation at 94 °C for 30 s, annealing at 52 °C (for matK) or 55 °C (for rbcL and the psbA-trnH spacer) for 30 s, extension at 72 °C for 1 min and a final extension at 72 °C for 5 min. The amplified products were subjected to 2% agarose gel electrophoresis.

DNA sequencing and sequences analyses

The specific fragments amplified were sequenced at the DNA Sequencing Unit, Faculty of Medicine, Ramathibodi Hospital, Bangkok, Thailand. The sequences were then analyzed using Blast tools (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Sequences were aligned for each genome region amplified to determine genetic distance values by MEGA6 (Tamura et al. 2013) using the Maximum Composite Likelihood method and are in the units of the number of base substitutions per site. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. The sequences were submitted to GenBank and corresponding accession numbers were given.

Results

Thirty-six Piper species were collected to construct barcodes. Because most of the Piper species that we investigated were wild, it was difficult to collect a sufficient amount of samples from all 36 Piper species to adequately construct barcodes. Sufficient samples were obtained for four species, P. nigrum, P. betle, P. sarmentosum and P. retrofractum, which are all economic plants.

The amplification of barcode bands from the matK region was not successful in two species, including P. montium and P. rubroglandulosum (♀). This may be because the DNAs were fragmented at the primer regions. Table 1 shows the GenBank accession numbers corresponding to 119 sequences from the matK, rbcL and psbA-trnH spacer regions for all 36 species studied.

GenBank accession numbers of DNA barcoding from three regions of Piper species.

Scientific name GenBank accession number#
matK psbA-trnH spacer rbcL
Piper argyritis KM073990 JX442927, KM055176 JX291978, KM055126
P. betle (♀) GU372747, KM098143 GQ891996, JQ248053 JQ248074
P. betle (♂) KM098144 JQ248050 JQ248071
P. betloides KM098135 JQ248051 JQ248072
P. boehmeriifolium KM073991, KM073992 KM055177, KM055178 KM055127, KM055128
P. caninum KM073993, KM073994 KM055179, KM055180 KM055129, KM055130
P. colubrinum GU372751, KM073995 GQ892000 KM055131
P. crocatum KM098136 JQ248047 JQ248068
P. dominantinervium KM073996, KM073997 KM055181, KM055182 KM055132, KM055133
P. hongkongense KM073998, KM073999 KM055183, KM055184 KM055134, KM055135
P. khasianum KM074000, KM074001 KM055185, KM055186 KM055136, KM055137
P. kraense KM074002, KM074003 KM055187, KM055188 KM055138, KM055139
P. longum KM074004, KM074005 KM055189, KM055190 KM055140, KM055141
P. maculaphyllum KM074006, KM098137 JQ248046, KM055191 JQ248067, KM055142
P. magnibaccum KM074007, KM074008 KM055192, KM055193 KM055143, KM055144
P. montium n/a KM055194, KM055195 KM055145, KM055146
P. mutabile KM074035 KM055196, KM055197 KM055147, KM055148
P. nigrum KM074009, KM074010 GQ891994, KM055198, KM055199 KM055149, KM055150
P. pedicellatum var. eglandulatum KM074011, KM074012 KM055200, KM055201 KM055151, KM055152
P. pendulispicum (♀) KM074013, GU372748 KM055202, GQ891997 KM055153, JX291979
P. phuwuaense KM074014, KM074015 KM055203, KM055204 KM055154, KM055155
P. pilobracteatum KM074016, KM074017, KM074018, KM074019 KM055205, KM055206, KM055207, KM055208 KM055156, KM055157, KM055158, KM055159
P. polysyphonum KM074020, KM074021 KM055209, KM055210 KM055160, KM055161
P. protrusum KM074032, KM074033 GU980900, KM055223 KM055172, KM055173
P. retrofractum GU372749, KM074034 GQ891998, KM055224 KM055175
P. ribesioides GU372750, KM074022 GQ891999, KM055211 KM055162
P. rubroglandulosum (♀) n/a JX442926 JX291977
P. rubroglandulosum (♂) KM098138 JX442925 JX291976
P. sarmentosum GU372746, KM074023, KM074024 KM055212, KM055213 KM055163, KM055164
P. semiimmersum KM098139 JQ248045 JQ248066
P. submultinerve KM098140 JQ248048 JQ248069
P. sylvaticum KM074025, KM074026 KM055214, KM055215 KM055174
P. sylvestre KM074027, KM074028 KM055216, KM055217 KM055165, KM055166
P. thomsonii var. trichostigma KM074029 KM055218 KM055167
P. tricolor KM098141 JQ248049 JQ248070
P. umbellatum n/a KM055219, KM055220 KM055168, KM055169
P. wallichii KM074030, KM074031 KM055221, KM055222 KM055170, KM055171
P. yinkiangense KM098142 JQ248052 JQ248073

The intraspecific genetic distances for each region were the following: 1) for the matK region, the lowest value of 0.000 was observed in P. dominantinervium, P. hongkongense, P. kraense and P. longum, while the highest value of 0.386 was observed for P. betle; 2) for the rbcL region, the lowest value of 0.000 was observed in P. dominantinervium, P. hongkongense, P. longum, P. pedicellatum, P. pilobracteatum, P. polysyphonum, P. sarmentosum, P. sylvestre and P. wallichii, while the highest value of 0.166 was observed in P. betle; 3) for the psbA-trnH spacer region, the lowest value of 0.000 was observed in P. dominantinervium, P. khasianum, P. kraense, P. longum, P. montium, P. mutabile, P. nigrum, P. pilobracteatum, P. polysyphonum and P. sarmentosum while the highest value of 0.117 was observed in P. boehmeriifolium.

The interspecific genetic distances for each region were the following: 1) for the matK region the lowest value of 0.000 was observed in the paired species P. kraense and P. dominantinervium, P. magnibaccum and P. kraense, P. phuwuaense and P. dominantinervium, P. phuwuaense and P. kraense, P. pilobracteatum and P. dominantinervium, P. pilobracteatum and P. kraense, P. pilobracteatum and P. phuwuaense and P. sylvestre and P. polysyphonum, while the highest value of 0.486 was observed between P. ribesioides and P. pilobracteatum; 2) for the rbcL region, the lowest value of 0.000 was observed between pairs P. dominantinervium and P. caninum, P. kraense and P. boehmeriifolium, P. maculaphyllum and P. khasianum, P. magnibaccum and P. khasianum, P. magnibaccum and P. caninum, P. magnibaccum and P. dominantinervium, P. montium and P. khasianum, P. montium and P. magnibaccum, P. mutabile and P. caninum, P. mutabile and P. dominantinervium, P. mutabile and P. magnibaccum, P. nigrum and P. caninum, P. nigrum and P. dominantinervium, P. nigrum and P. magnibaccum, P. nigrum and P. mutabile, P. pedicellatum and P. khasianum, P. pedicellatum and P. magnibaccum, P. pedicellatum and P. montium, P. pedicellatum and P. pendulispicum, P. pendulispicum and P. caninum, P. pendulispicum and P. dominantinervium, P. pendulispicum and P. magnibaccum, P. pendulispicum and P. mutabile, P. pendulispicum and P. nigrum, P. phuwuaense and P. caninum, P. phuwuaense and P. dominantinervium, P. phuwuaense and P. magnibaccum, P. phuwuaense and P. mutabile, P. phuwuaense and P. nigrum, P. phuwuaense and P. pedicellatum, P. pilobracteatum and P. caninum, P. pilobracteatum and P. mutabile, P. polysyphonum and P. khasianum, P. polysyphonum and P. magnibaccum, P. polysyphonum and P. montium, P. sarmentosum and P. longum, P. sylvestre and P. khasianum, P. sylvestre and P. magnibaccum, P. sylvestre and P. montium, P. thomsonii and P. nigrum, P. pilobracteatum and P. phuwuaense, P. polysyphonum and P. pendulispicum, P. polysyphonum and P. pedicellatum, P. sylvestre and P. pendulispicum, P. sylvestre and P. pedicellatum, P. sylvestre and P. polysyphonum, P. wallichii and P. umbellatum, P. protrusum and P. phuwuaense, and P. protrusum and P. pilobracteatum, while the highest value of 0.213 was observed in the P. betle and P. argyritis pair; 3) for the psbA-trnH spacer region the lowest value of 0.000 was observed in the pairs of P. montium and P. magnibaccum, P. pilobracteatum and P. caninum, P. polysyphonum and P. pedicellatum, P. ribesioides and P. pedicellatum, P. sarmentosum and P. longum, P. sylvestre and P. pedicellatum, P. wallichii and P. khasianum, P. wallichii and P. pedicellatum, P. protrusum and P. magnibaccum, P. sylvestre and P. polysyphonum, P. sylvestre and P. ribesioides, P. wallichii and P. polysyphonum, P. wallichii and ribesioides, P. wallichii and P. sylvestre, and P. yinkiangense and P. betle, while the highest value of 0.228 was observed between P. semiimmersum and P. umbellatum.

The genetic distance of the matK region in Table 2 is a representative example.

Genetic distance values of the matK region for Piper identification, a representative example.

P. argyritis P. betle P. betle P. betle P. betloides P. boehmeriifolium P. boehmeriifolium P. caninum P. caninum P. colubrinum P. colubrinum P. crocatum P. dominantinervium P. dominantinervium P. hongkongense P. hongkongense P. khasianum P. khasianum P. kraense P. kraense P. longum P. longum P. maculaphyllum P. maculaphyllum P. magnibaccum P. magnibaccum P. nigrum P. nigrum P. pedicellatum P. pedicellatum P. pendulispicum
P. argyritis .000
P. betle .323 .000
P. betle .076 .362 .000
P. betle .126 .386 .106 .000
P. betloides .249 .423 .262 .260 .000
P. boehmeriifolium .004 .323 .074 .124 .252 .000
P. boehmeriifolium .011 .325 .074 .126 .258 .009 .000
P. caninum .013 .328 .080 .132 .249 .009 .017 .000
P. caninum .013 .328 .080 .132 .249 .009 .017 .000 .000
P. colubrinum .020 .332 .087 .134 .267 .017 .022 .026 .026 .000
P. colubrinum .089 .375 .143 .195 .310 .085 .093 .093 .093 .072 .000
P. crocatum .054 .358 .106 .145 .267 .052 .056 .061 .061 .065 .130 .000
P. dominantinervium .004 .323 .072 .121 .252 .002 .007 .011 .011 .015 .087 .050 .000
P. dominantinervium .004 .323 .072 .121 .252 .002 .007 .011 .011 .015 .087 .050 .000 .000
P. hongkongense .013 .321 .080 .130 .260 .011 .011 .020 .020 .024 .095 .059 .009 .009 .000
P. hongkongense .013 .321 .080 .130 .260 .011 .011 .020 .020 .024 .095 .059 .009 .009 .000 .000
P. khasianum .007 .325 .076 .126 .249 .002 .011 .011 .011 .020 .087 .054 .004 .004 .013 .013 .000
P. khasianum .007 .325 .074 .124 .249 .004 .009 .013 .013 .017 .089 .052 .002 .002 .011 .011 .002 .000
P. kraense .004 .323 .072 .121 .252 .002 .007 .011 .011 .015 .087 .050 .000 .000 .009 .009 .004 .002 .000
P. kraense .004 .323 .072 .121 .252 .002 .007 .011 .011 .015 .087 .050 .000 .000 .009 .009 .004 .002 .000 .000
P. longum .013 .325 .080 .130 .258 .011 .015 .020 .020 .024 .091 .054 .009 .009 .017 .017 .013 .011 .009 .009 .000
P. longum .013 .325 .080 .130 .258 .011 .015 .020 .020 .024 .091 .054 .009 .009 .017 .017 .013 .011 .009 .009 .000 .000
P. maculaphyllum .065 .369 .130 .171 .282 .065 .072 .074 .074 .080 .141 .111 .065 .065 .074 .074 .063 .063 .065 .065 .072 .072 .000
P. maculaphyllum .054 .341 .072 .113 .249 .052 .054 .061 .061 .065 .130 .085 .050 .050 .059 .059 .054 .052 .050 .050 .054 .054 .111 .000
P. magnibaccum .007 .325 .074 .124 .249 .004 .009 .013 .013 .017 .089 .052 .002 .002 .011 .011 .002 .000 .002 .002 .011 .011 .063 .052 .000
P. magnibaccum .009 .323 .076 .124 .256 .007 .011 .015 .015 .015 .087 .054 .004 .004 .013 .013 .009 .007 .004 .004 .013 .013 .069 .054 .007 .000
P. nigrum .015 .334 .087 .130 .262 .017 .022 .026 .026 .030 .102 .061 .015 .015 .024 .024 .020 .017 .015 .015 .022 .022 .072 .063 .017 .020 .000
P. nigrum .009 .325 .080 .121 .249 .011 .015 .020 .020 .024 .095 .059 .009 .009 .017 .017 .013 .011 .009 .009 .017 .017 .072 .054 .011 .013 .020 .000
P. pedicellatum .011 .328 .080 .126 .252 .007 .015 .015 .015 .024 .091 .054 .009 .009 .017 .017 .009 .011 .009 .009 .013 .013 .067 .046 .011 .013 .022 .013 .000
P. pedicellatum .011 .325 .074 .124 .258 .009 .004 .017 .017 .022 .093 .056 .007 .007 .011 .011 .011 .009 .007 .007 .015 .015 .072 .054 .009 .007 .022 .015 .015 .000
P. pendulispicum .004 .325 .076 .126 .252 .007 .011 .015 .015 .020 .091 .050 .004 .004 .013 .013 .009 .007 .004 .004 .009 .009 .067 .050 .007 .009 .013 .009 .009 .011 .000

Discussion

Most of the 43 species of wild Piper in Thailand have many functional uses. Only four species, P. betle, P. retrofractum, P. nigrum and P. sarmentosum are economic and cultivated species, and all of these species are also used as ingredients in the products mentioned above in the introduction. Piper betle is a well-known species that is important for its chemical substances, including essential oils, chavicol, cineol and eugenol, which can be used for medicinal and insecticidal purposes. Because these plants are widely used, and used in several forms, which include plant parts, powdered preparations, capsule formulations and other preparations, their authenticity should be verified using DNA barcodes to establish the worthiness of these products for medicinal, cosmetics and house-hold use. To overcome the problems associated with identifying species based on morphological characters, DNA barcoding has been employed. For flowering plants in Thailand, the psbA-trnH spacer region was suggested as an efficient DNA barcode marker in Senna species (Monkheang et al. 2011), as well as Smilax and Cissus species (Kritpetcharat et al. 2011). In addition, the rbcL gene has been suggested as a marker in parasitic plants, including Scurrula, Dendrophthoe, Helixanthera, Macrosolen and Viscum species (Kwanda et al. 2013) and the matK gene marker was identified in some medicinal Piper species (Sudmoon et al. 2012). Therefore the authors selected these three regions for barcode promising in the Piper species.

The results from DNA barcoding 36 Piper species using three different marker regions support a previous hypothesis of genetic distance values (Hebert et al. 2003), showing a significant variance in sequences between species and a comparatively small variance within species. Note that the economic and planted species, P. betle had the highest intraspecific genetic distance values of 0.386 for the matK region, which may have been due to the presence of human growth factors. The interspecific genetic distances for the matK region were effective for the identification of different species with 27 pairs of species ranging from a low of 0.002 to a high of 0.486, as shown in Table 2 and eight unidentified species pairs had a genetic distance of 0.000. This result agrees with the study by Hao et al. (2013) who claimed that matK had high species identification reliability and suggested that this region should be used for identification of Piper species along with the ITS region. Additionally, the rbcL and psbA-trnH spacer regions are effective for further identification of the other eight species pairs as shown in Table 3. The lowest genetic distance value is 0.010 of the pair P. sylvestre and P. polysyphonum to the highest value 0.129 for the pair P. phuwuaense and P. kraense in psbA-trnH spacer region. It can be concluded that these three barcode regions are powerful for further efficient identification of the 36 Piper species.

Interspecific genetic distance values for identification of the eight pairs Piper species by rbcL and psbA-trnH spacer sequences.

Pairs of species matK region rbcL region psbA-trnH spacer region
P. kraense and P. dominantinervium 0.000 0.005-0.008 0.111-0.117
P. magnibaccum and P. kraense 0.000 0.008 0.1110-0.123
P. phuwuaense and P. dominantinervium 0.000 0.000-0.003 0.021-0.026
P. phuwuaense and P. kraense 0.000 0.005-0.008 0.021-0.129
P. pilobracteatum and P. dominantinervium 0.000 0.003 0.021
P. pilobracteatum and P. kraense 0.000 0.003 0.010-0.123
P. pilobracteatum and P. phuwuaense 0.000 0.003 0.016-0.021
P. sylvestre and P. polysyphonum 0.000 0.000 0.000-0.010

The results presented here support those of Newmaster et al. (2007), who proposed to use matK and the psbA-trnH spacer to identify Myristicaceae plants, Sudmoon et al. (2012) who recommended independent analysis of each barcode region, and CBOL Plant Working Group (2009) who proposed rbcL and matK as the core DNA barcode regions for land plants.

Acknowledgments

The authors are grateful for the financial support provided by the Thailand Research Fund through the Research Career Development Grant (Grant No. RSA5580054). The authors confirm that there is no conflict of interest.

References

  • Banka RA, Teo SP (2000) Piper betle. In: van der Vossen HAM, Wessel M (Eds) PROSEA 16 Stimulant Plants. Backhuys, Leiden, 135–140. doi: 10.1073/pnas.0905845106
  • CBOL Plant Working Group (2009) A DNA barcode for land plants. Proceedings of the National Academy of Sciences of the United State of America 106: 12794–12797. doi: 10.17348/era.4.0.223-231
  • Chaveerach A, Mokkamul P, Sudmoon R, Tanee T (2006a) Ethnobotany of the genus Piper (Piperaceae) in Thailand. Ethnobotany Research and Applications 4: 223–231.
  • Chaveerach A, Sudmoon R, Tanee T, Mokkamul P (2006b) Three new species of Piperaceae from Thailand. Acta Phytotaxonomica Sinica 44: 447–453. doi: 10.1360/aps040163
  • Chaveerach A, Sudmoon R, Tanee T, Mokkamul P (2008) The species diversity of the genus Piper from Thailand. Acta Phytotaxonomica et Geobotanica 59: 105–163.
  • Chaveerach A, Sudmoon R, Tanee T, Mokkamul P (2009) The genus Piper in Thailand, 2nd edition. Khon Kaen Kanpim Printing, Khon Kaen, 172 pp.
  • Chaveerach A, Tanee T, Sudmoon R (2011) Molecular identification and barcodes for the genus Nymphaea. Acta Biologica Hungarica 62: 328–340. doi: 10.1556/ABiol.62.2011.3.11
  • Chaveerach A, Tanomtong A, Sudmoon R, Tanee T, Mokkamul P (2007) A new species and two new varieties of Piper (Piperaceae) from Thailand. Acta Phytotaxonomica et Geobotanica 58: 33–38.
  • Fan LS, Muhamad R, Omar D, Rahmani M (2011) Insecticidal properties of Piper nigrum fruit extracts and essential oils against Spodoptera litura. International Journal of Agriculture and Biology 13: 517–522.
  • Hebert PDN, Stoeckle MY, Zemlak TS, Francis CM (2004) Identification of birds through DNA barcodes. PLoS Biology 2: 1657–1663. doi: 10.1371/journal.pbio.0020312
  • Hebert PDN, Cywinska A, Ball SL, De Waard JR (2003) Biological identifications through DNA barcodes. Proceedings of the Royal Society of London Series B 270: 313–321. doi: 10.1098/rspb.2002.2218
  • Hollingsworth PM, Graham SW, Little DP (2011) Choosing and using a plant DNA barcode. PLoS ONE 6: e19254. doi: 10.1371/journal.pone.0019254
  • Kritpetcharat O, Kritpetcharat P, Daduang J, Daduang S, Suwanrungruang K, Khemtonglang N, Bletter N, Sudmoon R, Chaveerach A (2011) Using DNA markers and barcoding to solve the common problem of identifying dried medicinal plants with the examples of Smilax and Cissus in Thailand. Journal of Medicinal Plants Research 5: 3480–3487.
  • Kwanda N, Noikotr K, Sudmoon R, Tanee T, Chaveerach A (2013) Medicinal parasitic plants on diverse hosts with their usages and barcodes. Journal of Natural Medicines 67: 438–445. doi: 10.1007/s11418-012-0695-2
  • Misra P, Kumar A, Khare P, Gupta S, Kumar N, Dube A (2009) Pro-apoptotic effect of the landrace Bangla Mahoba of Piper betle on Leishmania donovani may be due to the high content of eugenol. Journal of Medical Microbiology 58: 1058–1066. doi: 10.1099/jmm.0.009290-0
  • Monkheang P, Sudmoon R, Tanee T, Noikotr K, Bletter N, Chaveerach A (2011) Species diversity, usages, molecular markers and barcode of medicinal Senna species (Fabaceae, Caesalpinioideae) in Thailand. Journal of Medicinal Plants Research 5: 6173–6181. doi: 10.5897/jmpr11.1075
  • Newmaster SG, Fazekas AJ, Steeves RAD, Janovec J (2007) Testing candidates plant barcode regions in the Myristicaceae. Molecular Ecology Resources 8: 480–490. doi: 10.1111/j.1471-8286.2007.02002.x
  • Sanubol A, Chaveerach A, Sudmoon R, Tanee T, Noikotr K, Chuachan C (2014) Betel-like-scented Piper plants as diverse sources of industrial and medicinal aromatic chemicals. Chiang Mai Journal of Science 41: 1171–1181.
  • Scott IM, Jensen HR, Philogène BJR, Arnason JT (2008) A review of Piper spp. (Piperaceae) phytochemistry, insecticidal activity and mode of action. Phytochemistry Reviews 7: 65–75. doi: 10.1007/s11101-006-9058-5
  • Silayoi I, Krengpiem P, Disthabanchong A (1985) Effectiveness of systemic fungicides for control of Phytophthora parasitica NK1 in foot rot of Piper betle. Thai Agricultural Research Journal 3: 104–107.
  • Sudmoon R, Tanee T, Chaveerach A (2011) Piper protrusum (Piperaceae), a new species from southern Thailand based on morphological and molecular evidence. Journal of Systematics and Evolution 49: 468–475. doi: 10.1111/j.1759-6831.2011.00148.x
  • Sudmoon R, Tanee T, Wongpanich V, Bletter N, Chaveerach A (2012) Ethnobotany and species specific molecular markers of some medicinal sakhan (Piper, Piperaceae). Journal of Medicinal Plants Research 6: 1168–1175.
  • Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30: 2725–2729. doi: 10.1093/molbev/mst197
  • Yusoff Z, Mahmud Z, Saleh SH, Mohd EY (2005) Study on the chemical constituents of Piper betle L. in relation to their possible insect attractant property. Malaysian Journal of Science 24: 143–147.
  • Zhang JB, Hanner R (2012) Molecular approach to the identification of fish in the South China Sea. PLoS ONE 7: e30621. doi: 10.1371/journal.pone.0030621