Research Article
Print
Research Article
Finding missing diversity from synonyms of Haplopteris (Pteridaceae)
expand article infoZuo-Ying Wei‡§, Zeng-Qiang Xia|§, Xian-Chun Zhang, Jian-Guo Cao‡, Yue-Hong Yan§
‡ Shanghai Normal University, Shanghai, China
§ National Orchid Conservation center of China and the Orchid Conservation & research Center of Shenzhen, Shenzhen, China
| Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, Shanghai, China
¶ Institute of Botany, The Chinese Academy of Sciences, Beijing, China

Corresponding author: Yue-Hong Yan ( yan.yh@126.com )

Academic editor: Blanca León
© 2021 Zuo-Ying Wei, Zeng-Qiang Xia, Xian-Chun Zhang, Jian-Guo Cao, Yue-Hong Yan.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Wei Z-Y, Xia Z-Q, Zhang X-C, Cao J-G, Yan Y-H (2021) Finding missing diversity from synonyms of Haplopteris (Pteridaceae). PhytoKeys 178: 81-94. https://doi.org/10.3897/phytokeys.178.67622
Open Access

Abstract

Although taxonomists target the remote wild regions to discover new species, taxa lacking a comprehensive and modern systematic treatment may be the new hotspot for biodiversity discovery. The development of molecular systematics integrated with microscopic observation techniques has greatly improved the ability of taxonomists to identify species correctly. Vittaria centrochinensis Ching ex J.F. Cheng, regarded as a synonym of Haplopteris fudzinoi (Makino) E.H.Crane, remained hidden from the eyes of fern taxonomists for more than 20 years. Herein, we collected several population samples of V. centrochinensis by performing molecular phylogenetic analysis of five cpDNA regions (rbcL, atpA, matK, ndhF, and trnL-trnF) and through micromophological observation of specimens which differs from H. fudzinoi by lamina width and exospores. Considering the differences in morphology, geographical range, and genetic distance between these two species, we formally recognized V. centrochinensis as an authentic species and proposed a new combination Haplopteris centrochinensis (Ching ex J.F.Cheng) Y.H.Yan, Z.Y.Wei & X.C.Zhang, comb. nov. Our findings demonstrate that several taxa in synonyms are missing, and nowadays taxonomy should also include re-evaluation of the past taxonomy.

Keywords

Haplopteris, molecular phylogeny, new combination, nomenclature, Pteridaceae, taxonomy

Introduction

The question “How many species are there on earth?” is one of the top 125 questions in science, and exploring it is considered equivalent to imagining the number of stars in the sky (Kennedy and Norman 2005). To understand the biodiversity of species, taxonomists should not only explore new species but also re-evaluate the published species’ names that are considered synonymous with older species’ names. According to the stasis of the web of TPL (The Plant List 2013), more than one-third of species names are unclear and approximately one-third of species names are considered synonymous. Unfortunately, once a species name is treated as a synonym, it remains in the pile of synonyms forever. With the development in molecular phylogeny research, DNA barcoding, and detailed taxonomic observations, an increasing number of species names have been re-established from the checklist of synonyms, which ranges from ferns (Shu et al. 2017; Shu et al. 2018; Wei et al. 2018; Wang et al. 2020) to spermatophyte (Luo et al. 2016; Jin et al. 2017; Wang et al. 2018). Consequently, we found that the synonym database could be a new hotspot for biodiversity discovery.

Accurate specimen identification through sequencing of the type specimens or samples from type locality is the key to solving questions regarding taxonomic synonyms. In addition, a clear understanding of the taxonomic status and barcoding database of the species suspected of being independent is required. Haplopteris C.Presl is a genus of vittarioid ferns, long treated as a synonym of Vittaria Sm. (Kramer 1990; Wu and Ching 1991; Chen et al. 2013). Recently, it has been widely adopted and followed that the Old World Vittaria species were transferred to Haplopteris (Chen et al. 2013). Because of limited morphology exhibited by members of the Haplopteris as well as convergent and parallel evolution of morphological characteristics, the circumscription of species in the genus has been ambiguous. Vittaria centrochinensis Ching ex J.F.Cheng, just one of a long sleeping suspicious species in the synonym list of Haplopteris, was initially published in “Flora of Jiangxi” (Xu 1993) as a new species and subsequently considered as a synonym of V. fudzinoi (Zhang 1999). To date, it has been regarded as a synonym of Haplopteris fudzinoi (Makino) E.H.Crane (Zhang and Gilbert 2013; Yan et al. 2016). Haplopteris fudzinoi is a species originally described in Japan, and then used to refer to a Chinese fern (Zhang 1999). During our field investigation in Wuyi Mountain (Jiangxi, China), we collected some population samples of V. centrochinensis and found some obvious differences between V. centrochinensis and H. fudzinoi.

In this study, we analyzed morphological characteristics and geographic distribution along with the molecular phylogeny to confirm the identity of V. centrochinensis and phylogenetic affinities of this species with H. fudzinoi. We hope that this study can provide a paramount example of re-evaluating of synonyms for new insights into biodiversity discovery.

Materials and methods

Morphological analyses and geographical distribution

For morphology, the H. centrochinensis was compared with similar species by analyzing photographs of type specimens and field photos. The features of rhizome scales were obtained using Nikon SMZ-1500 (Japan). The morphology of spores was observed with a Quanta 250 scanning electron microscope (FEI, USA), and spore size was measured using ImageJ software (Collins 2007). The descriptions of spore ornamentation abided by Wang and Dai (2010) and Ranker et al. (1993). The map of the geographical distribution of two species, namely H. centrochinensis and H. fudzinoi, was obtained through field investigation and National Specimen Information Infrastructure (NSII). The specimens of H. centrochinensis in this study were deposited in Shanghai Chenshan Herbarium (CSH).

Phylogenetic analyses

The total genomic DNA was extracted from silica-dried leaves by using a plant total genomic DNA kit (Tiangen, Beijing, China), according to the manufacturer’s instructions. The primers used for amplification and sequencing were shown in Table 1. Sequencing was performed with an ABI 3730xl DNA analyzer (Applied Biosystems, Foster City, CA, USA). The cpDNA sequences of the three samples of H. centrochinensis were submitted to GenBank under accession numbers: MW810047–MW810061 (Table 2). In addition, five cpDNA regions of nine species were downloaded from GenBank (Table 3). Of these, the unavailable data (Table 3) were treated as missing data when they were concatenated. The newly generated sequences were assembled and edited using SeqMan (Burland 1999). Subsequently, all sequences were aligned and manually adjusted on MEGA software (v7.0) (Kumar et al. 2016), with default alignment parameters. Alignments of five cpDNA regions were concatenated using PhyloSuite (Zhang et al. 2018). Then the matrix was used to construct phylogenetic trees with maximum likelihood (ML) and MrBayes. Maximum likelihood analysis was conducted using IQ-TREE (Nguyen et al. 2015) integrated in PhyloSuite with standard bootstrap and TVM+F+G4 model. Bayesian analysis was performed using MrBayes (v3.2.6) (Ronquist et al. 2012) with the GTR+F+G4 model. Four Markov chains were run 1,000,000 generations, with the sampling frequency of 100. The standard deviation of split frequencies was set to less than 0.01 to achieve the convergence of the independent runs. A majority-rule consensus tree was constructed to estimate the posterior probabilities (PP); the first 25% of samples were discarded as the burn-in phase.

Table 1.
Download as
CSV
XLSX

List of PCR amplification and sequencing primers used in the study.

Regions Primer name Primer sequence (5’-3’) Reference
rbcL AF ATGTCACCACAAACGGAGACTAAAGC Hasebe et al. (1994)
ESRBCL1361R TCAGGACTCCACTTACTAGCTTCACG Schuettpelz and Pryer (2007)
atpA ESATPF412F GARCARGTTCGACAGCAAGT Schuettpelz et al. (2006)
ESTRNR46F GTATAGGTTCRARTCCTATTGGACG Schuettpelz et al. (2006)
matK Vt matK1610F* GCARTCAARCGTTTAATTRGTA Chen et al. (2013)
Vt matK rRFQ TTATTACTGAATTTGGRATCT Chen et al. (2013)
ndhF Vt ndhF fAYS GCTTATTCTACHATGTCTCAGYTRGGATATATGG Kuo et al. (2016)
Vt trnN 2210R TCGTGARACGAAAATAGCAGTTTATGG Kuo et al. (2016)
trnL-F F ATTTGAACTGGTGACACGAG Taberlet et al. (1991)
FernL 1Ir1 GGYAATCCTGAGCCAAATC Li et al. (2010)
Table 2.
Download as
CSV
XLSX

GenBank accession number of sequences newly generated in this study.

Species Location Voucher GenBank accession number
rbcL atpA matK ndhF trnL-trnF
Haplopteris centrochinensis comb. nov. Jiangxi, China YYH15442-1 MW810047 MW810050 MW810053 MW810056 MW810059
Haplopteris centrochinensis comb. nov. Jiangxi, China YYH15442-2 MW810048 MW810051 MW810054 MW810057 MW810060
Haplopteris centrochinensis comb. nov. Jiangxi, China YYH15442-3 MW810049 MW810052 MW810055 MW810058 MW810061
Table 3.
Download as
CSV
XLSX

Information on species and GenBank accession numbers used in the study. Dash (-) indicates unavailable data.

Species Location Voucher GenBank accession number
rbcL atpA matK ndhF trnL-trnF
Haplopteris taeniophylla (Copel.) E.H. Crane Luzon, Philippines FWL974 – – KC812901 KC812935 KC812969
Nantou, Taiwan, China Chen1493 – – KC812874 KC812908 KC812942
Haplopteris doniana (Mett. ex Hieron.) E.H. Crane Yunnan, China Kuo1418 – – KC812880 KC812914 KC812948
Tamdao, Vietnam Kuo1801 – – KC812905 KC812939 KC812973
Haplopteris fudzinoi (Makino) E.H. Crane Sichuan, China Kuo2225 KX165003 KX165201 KC812895 KC812929 KC812963
Haplopteris linearifolia (Ching) X.C. Zhang Yunnan, China Liu9457 KX165012 KX165209 KC812899 KC812933 KC812967
Haplopteris mediosora (Hayata) X.C. Zhang Nantou, Taiwan Chen1492 KX165015 KX165211 KC812875 KC812909 KC812943
Haplopteris amboinensis (Fée) X.C. Zhang Hainan, China Kuo1715 – – KC82879 KC812913 KC812947
Haplopteris flexuosa (Fée) E. H. Crane Yunnan, China Kuo1142 – – KC812881 KC812915 KC812949
Antrophyum parvulum Blume Nantou, Taiwan, China Chen1495 – – KC812877 KC812911 KC812945
Antrophyum sessilifolium (Cav.) Spreng Taitung, Taiwan, China Chen1502 KX164974 KX165181 KC812876 KC812910 KC812944

Results

Morphological comparisons and geographical distribution

The morphological and micromorphological characters of H. centrochinensis and H. fudzinoi are presented in Figure 1 and Table 4. The lamina of H. centrochinensis was shorter and wider than that of H. fudzinoi (Fig. 1A, B, F); in H. fudzinoi costa it was raised adaxially with two prominent long grooves beside the costa on adaxial surface (Fig. 1D). The rhizome scales were yellow-brown, margin denticulate, linear-lanceolate, and clathrate (Fig. 1E left); scale margins of H. centrochinensis were toothed and those of H. fudzinoi were subentire to minutely denticulate at lower margin and upper part, respectively. The scales length of H. centrochinensis were visibly longer than that of H. fudzinoi (Fig. 1E). Spores were monolete for both the species. Spore ornamentation observed in H. centrochinensis was scabrate and rugate (Fig. 1G, I), whereas it was laevigate or inconspicuous-granulate in H. fudzinoi (Fig. 1H, J). Additionally, sori position was distinct between the two species; the soral line in H. fudzinoi was located close to the edge of lamina and immersed in groove (Fig. 1D), whereas it was immersed between the frond costa and margin in H. centrochinensis (Fig. 1C). The geographical distribution for these two species was obtained on the basis of the information of the specimens. The result indicated that most distributions are shared by H. centrochinensis and H. fudzinoi (Fig. 3).

Table 4.
Download as
CSV
XLSX

Morphological comparisons between H. centrochinensis and H. fudzinoi.

Features H. centrochinensis H. fudzinoi
Lamina width 10–15 mm 8–10 mm
Lamina margin Flat Reflexed
Adaxial costa Slightly raised Greatly raised
Abaxial costa Carinated Sharp carinate
Rhizome scale Long, margin toothed Short, lower margin subentire, upper part minutely denticulate
Exospores Scabrate Psilate
Sorus position Between the frond costa and margin Close to the lamina edge
Figure 1. 

Morphological observations in H. centrochinensis YYH15442 (A, C, F, G, I) and H. fudzinoi SG1654 (B, D, H, J) A habitat C sorus position and flat lamina F type specimen (provided by National Plant Specimen Resource Center, http://www.cvh.ac.cn); and G, I spore and ornamentation in H. centrochinensis YYH15442 B habitat (taken by Hong-Jin Wei) D sorus position and flat lamina (taken by Hong-Jin Wei) H, J spore and ornamentation in H. fudzinoi SG1654 E rhizome scale, left: H. fudzinoi, right: H. centrochinensis.

Haplopteris centrochinensis is an independent species according to molecular data obtained using phylogenetic analysis

The two phylogenetic analyses (BI, ML) recovered congruent topologies, with Antrophyum parvulum and Antrophyum sessilifolium as outgroups (Fig. 2). The results revealed strong support for the monophyly of H. centrochinensis (PP = 1.0, BS = 100) (Fig. 2), and it was strongly supported as a sister to another four species (i.e., H. fudzinoi, H. doniana, H. taeniophylla, and H. linearifolia) of Haplopteris (PP = 1.0, BS = 100) (Fig. 2). The genetic distance between the H. centrochinensis and these four Haplopteris species ranged from 0.073 to 0.120, and the intraspecific distances of these four species were 0 and 0.001 (Table 5).

Table 5.
Download as
CSV
XLSX

Genetic distance between eight individuals of five Haplopteris species.

1 2 3 4 5 6 7
2 0.073*
3 0.120* 0.001
4 0.120* 0 0
5 0.120* 0.001 0.001 0.001
6 0.120* 0.001 0.001 0.001 0
7 0.120* 0 0 0 0.001 0.001
8 0.073* 0 0 0.000 0.001 0.001 0

Note: 1 = H. centrochinensis (YYH15442); 2 = H. fudzinoi (Kuo2225); 3 = H. donoana (Kuo 1418); 4 = H. doniana (Kuo1801); 5 = H. taeniophylla (Chen 2086); 6 = H. taeniophylla (Chen 1493); 7 = H. taeniophylla (FWL 974); 8 = H. linearifolia (Liu 9457); Genetic distances of H. centrochinensis from others species are shown with *.
Figure 2. 

Majority consensus tree derived from Bayesian tree based on 5 cpDNA loci (rbcL, atpA, matK, ndhF, and trnL-F). Numbers above the branches are support values in the order of PPBI/BSML.

Figure 3. 

Geographic distribution of H. centrochinensis and H. fudzinoi in China. The dataset is provided by the National Specimen Information Infrastructure (http://www.nsii.org.cn).

Discussion

Re-evaluation of synonyms for new insights into biodiversity discovery

Synonym is the first concern in the estimation of the total number of species in one taxon, and only after its resolution can one ask the next question regarding how many additional species there are in the taxon (Joppa and Pimm 2011). Surprisingly, nearly two-thirds of the plant names are synonymous or recorded as unresolved in TPL (2013), which consists of 26,000 additional synonyms that were not listed in its earlier version (v.1.0). The increase in the number of newly discovered species has been consistent in line with the use of molecular evidence; however, information on synonyms is meager. For instance, International Plant Names Index (IPNI 2020) provides information on nomen novum, combination nova, and taxa nova, but it provides no information on new species resurrected from the established synonyms. Although many species of ferns (Liu et al. 2013; Morigengaowa et al. 2018; Shu et al. 2017; Shu et al. 2018; Sigel et al. 2014; Wang et al. 2020; Wei et al. 2018) and seed plants (Tkach et al. 2015; Hu et al. 2015) have been reinstated as independent species, this type of study has been rarely reported. The extent of biodiversity hidden in taxonomic literature is an interesting question to explore. To understand the biodiversity of our planet and for efficient conservation of valuable natural resources, the prime objective of taxonomists should be to correctly identify our planet biodiversity by using modern taxonomic facilities.

Various taxa, especially widely distributed ones, still require a comprehensive systematic treatment that also involves evaluating their nomenclature. Then, if cryptic taxa or misunderstood species have to be segregated, naming these taxa needs first to be evaluated against synonymy as potential sources of the needed name, otherwise a new name needs to be proposed. However, the number of taxonomists has significantly declined (Haas and Hauser 2005), and young taxonomists do not pay enough attention either to the evaluation of synonymous names already listed in the taxonomy or to the assessment of thousands of different species names and their type specimens. Therefore, the number of species on earth remains uncertain. Fortunately, technological advancement has considerably affected taxonomy. According to the IPNI data, two obvious turning points in taxonomy have affected the trends in new combinations and new taxa (Fig. 4), and those are related to the development of electron microscopy and molecular phylogeny in the 1970s and the 1990s, respectively (Endess et al. 2000). Although the new taxa have been displaying a steady or even a downward trend, the new combination is expected to display an upward trend in future, with the application of molecular biology in taxonomy (Fig. 4). Unsurprisingly, new combinations will continue to occur for a long time because of the abundance of listed synonyms and suspected species names, which are equivalent to the new species in the wild. Thus, synonyms and suspected species will serve as the new biological diversity hotspot for the exploration of new unknown species.

Figure 4. 

Trends in the number of new names, new combinations, and new taxa published over 50 years (1970–2020).

Integrative taxonomy contributes to clarifying species delimitation

The reason for numerous synonyms existing only in books may be the lack of sufficient morphological judgments made in the past. In the present study, the phylogeny (Fig. 2) based on the 5-locus dataset revealed strong support for the monophyly of H. centrochinensis (PP = 1.0, BS = 100) (Fig. 2) and strong support for H. centrochinensis as sister to H. fudzinoi (PP = 1.0, BS = 100) (Fig. 2). Although our result was different from that of a study by Zhang and Gilbert (2013) that indicated distinction between the two species, no further research was performed merely because of limited conditions at that time. Moreover, genetic distance in line with the K2P model showed an obvious hereditary difference between the H. centrochinensis and another three Haplopteris species (Table 5). For morphological comparisons, several traits were observed. Of these, the most unambiguous differences between the two species (H. centrochinensis and H. fudzinoi) were the wider lamina, longer rhizome scale, and shorter stipe in H. centrochinensis. In addition, H. fudzinoi costa was raised adaxially with two prominent long grooves besides the costa on adaxial surface. Furthermore, the scabrate and rugate ornamentation of spores observed in H. centrochinensis was found to be laevigate or inconspicuous-granulate in H. fudzinoi. To sum up, monophyletic clade, long genetic distance, stable morphological differentiation, and independent geographical distribution form the basis of establishing H. centrochinensis as a divergent species or an independent species, and therefore, it should not be considered synonymous with H. fudzinoi.

Here, we proposed a new combination H. centrochinensis (Ching ex J.F.Cheng) Y.H.Yan, Z.Y.Wei & X.C.Zhang, comb. nov. The taxonomic treatment of H. centrochinensis is as follows.

Taxonomic treatment

Haplopteris centrochinensis (Ching ex J.F. Cheng) Y.H.Yan, Z.Y.Wei & X.C.Zhang, comb. nov.

urn:lsid:ipni.org:names:77217251-1

Vittaria centrochinensis Ching ex J.F.Cheng: Fl. Jiangxi 1: 365. 1993. Basionym.

Vittaria taeniophylla sensu F.Zhang, non Copel.: Fl. Zhejiang 1: 111. 1993. p.p.

Vittaria fudzinoi sensu X.C.Zhang, non Makino: Fl. Rep. Poup. Sin. 3(2):20.1999. p.p.

Haplopteris fudzinoi sensu Zhang & Gilbert, non (Makino) E. H. Crane: Fl. China 2(3): 254.2013. p.p.

Type

China. Hubei Province, Enshi Tujia and Miao Autonomous Prefecture, Hefeng District, elev. 1200 m, October 1958, Hong-Jun Li, 8394 (holotype, PE!; isotypes, IBSC!, NAS!).

Additional specimens examined

Guangxi Province: Damiaoshan District, 26 July 1958, Shao-Qing Chen, 15853 (IBSC); Quanzhou District, April 27, 2013, Quanzhou census team, 450324130427042LY (GXMG). Guizhou Province: Kaili City, census team, 3592 (CNBG); Xingren District, 9 August 1960, census team, 7872 (CNBG); Yinjiang, December 26, 1930, Y. Tsiang, 7867 (CNBG). Hunan Province: Shaoyang City, Dongkou District, 24 May 1983, Ze-Yong Yang, 166 (IBSC); Xinning District, September 9, 1984, Anonymous, 394 (PE). Jiangxi Province: Shangrao City, Yanshan District, Wuyi Mountain National Nature Reserve, 1729 m, October 7, 2019, Yue-Hong Yan, Zuo-Ying. Wei, Quan Yuan, YYH15442 (NOCC); Shangrao City, Yushan District, Sanqingshan, July 27, 1991, Sheng-Xiu Xu, 91018 (JXU); Jinggangshan City, Jinggangshan, April 13, 1983, Sheng-Xiu Xu, 83422 (JXU); Jinggangshan City, Jinggangshan, February 1982, 8210118 (JXU); Jinggangshan City, Jinggangshan, November 4, 1982, 8220349 (JXU); Jinggangshan City, Jinggangshan, July 2, 1973, Jing -Fu Cheng, 730433 (JXU); Shangrao City, Yushan District, Huaiyushan, July 1970, 0028466 (PEY); Pingxiang City, Luxi District, March 24, 2014, Gong-Xi, Chen and Dai-Gui Zhang, LXP-06-1246, LXP-06-1251, LXP-06-1201 (SYS). Zhejiang Province: Quzhou City, Kaihua District, September 1, 2019, She-Lang Jin, Hong-Yu Wei, Jiao Zhang, JSL5850 (CSH); Longquan City, September 27, 1963, Shao-Guang Zhang, 4453 (CNBG); Linan City, May 25, 1958, Anonymous, 28714; Qingyuan District, Pei-Xi Qiu, 3935 (PE); Taishun District, July 17, 1960, Anonymous, 8576 (CNBG).

Note

Vittaria centrochinensis Ching ex J.F.Cheng was initially published in “Flora of Jiangxi” as a new species found in two distributed provinces (i.e., Jiangxi and Hubei). The type locality is situated in the Hefeng District from which a single specimen was cited. Additional specimens were cited from Jiangxi Province.

Acknowledgments

We thank NSII and Shanghai Chenshan Herbarium (CSH) for providing online specimen images, and Hong-Jin Wei and Yu-Feng Gu for taking photos of H. fudzinoi. We are grateful to Quan Yuan for helping with the field investigation. We thank Hui Shen, Rui Zhang, Dong-Mei Jin, Hui Shang, Wen Shao and Yu-Feng Gu for helping in the experiment. We appreciate the useful suggestions provided by the editor and an anonymous reviewer. We would like to thank TopEdit (www.topeditsci.com) for its linguistic assistance during the preparation of this manuscript. This project was supported by the Strategic Priority Research Program of the Chinese Academy of Sciences (project numbers XDA19050404), the Basic Project of Ministry of Science and Technology of China (project numbers 2015FY110200) and Shenzhen Key Laboratory for Orchid Conservation and Utilization.

References

  • Chen CW, Huang YM, Kuo LY, Chang YH, Liu YC, Chiou WL (2013) A new vittarioid fern species, Haplopteris heterophylla (Pteridaceae). Systematic Botany 38(4): 901–909. https://doi.org/10.1600/036364413X674805
  • Endess PK, Baas P, Gregory M (2000) Systematic plant morphology and anatomy-50 years of progress. Taxon 49(3): 401–434. https://doi.org/10.2307/1224342
  • Haas F, Hauser CL (2005) Taxonomists: An endangered species. Success Stories in Implementation of the Programmes of Work on Dry and Sub-Humid Lands and the Global Taxonomy Initiative, 87–79.
  • Hasebe M, Omori T, Nakazawa M, Sano T, Kato M, Iwatsuki K (1994) rbcL gene sequences provide evidence for the evolutionary lineages of leptosporangiate ferns. Proc. Proceedings of the National Academy of Sciences of the United States of America 91(12): 5730–5734. https://doi.org/10.1073/pnas.91.12.5730
  • Hu H, Al-Shehbaz IA, Sun YS, Hao GQ, Liu JQ (2015) Species delimitation in Orychophragmus (Brassicaceae) based on chloroplast and nuclear DNA barcodes. Taxon 64(4): 714–726. https://doi.org/10.12705/644.4
  • IPNI (2020) International Plant Names Index. Published on the Internet http://www.ipni.org, The Royal Botanic Gardens, Kew, Harvard University Herbaria & Libraries and Australian National Botanic Gardens.
  • Jin WT, Schuiteman A, Chase MW, Li JW, Chung SW, Hsu TC, Jin XH (2017) Phylogenetics of subtribe Orchidinae s.l. (Orchidaceae; Orchidoideae) based on seven markers (plastid matK, psaB, rbcL, trnL-F, trnH-psbA, and nuclear nrits, Xdh): Implications for generic delimitation. BMC Plant Biology 17(1): e222. https://doi.org/10.1186/s12870-017-1160-x
  • Joppa LN, Pimm RSL (2011) How many species of flowering plants are there? Proceedings of the Royal Society B: Biological Sciences 278(1705): 554–559. https://doi.org/10.1098/rspb.2010.1004
  • Kramer KU (1990) Vittariaceae. In: Kramer KU, Green PS (Eds) The Families and Genera of Vascular Plants (Vol. 1). Pteridophytes and gymnosperms. Springer-Verlag, Berlin, 272–277. https://doi.org/10.1007/978-3-662-02604-5_46
  • Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870–1874. https://doi.org/10.1093/molbev/msw054
  • Kuo LY, Chen CW, Shinohara W, Ebihara A, Kudoh H, Sato H, Huang YM, Chiou WL (2016) Not only in the temperate zone: Independent gametophytes of two vittarioid ferns (Pteridaceae, Polypodiales) in East Asian subtropics. Journal of Plant Research 130(2): 255–262. https://doi.org/10.1007/s10265-016-0897-x
  • Liu HM, Jiang RH, Guo J, Hovenkamp P, Perrie L, Shepherd L, Hennequin S, Schneider H (2013) Towards a phylogenetic classification of the climbing fern genus Arthropteris. Taxon 62(4): 688–700. https://doi.org/10.12705/624.26
  • Luo JP, Hong Y, Ren C, Yang QE, Yuan Q (2016) Reinstatement of the Chinese species Cimicifuga lancifoliolata (Ranunculaceae). Nordic Journal of Botany 000: 001–014.
  • Morigengaowa, Luo JJ, Knapp R, Wei HJ, Liu BD, Yan YH, Shang H (2018) The identity of Hypolepis robusta, as a new synonym of Hypolepis alpina (Dennstaedtiaceae), based on morphology and DNA barcoding and the new distribution. PhytoKeys 96: 35–45. https://doi.org/10.3897/phytokeys.96.23470
  • Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Ranker TA, Tyron AF, Lugardon B (1993) Spores of the Pteridophyta: Surface, wall structure, and diversity based on electron microscope studies. Systematic Botany 18(2): 377–378. https://doi.org/10.2307/2419410
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029
  • Schuettpelz E, Pryer KM (2007) Fern phylogeny inferred from 400 leptosporangiate species and three plastid genes. Taxon 56(4): 1037–1050. https://doi.org/10.2307/25065903
  • Schuettpelz E, Korall P, Pryer KM (2006) Plastid atpA data provide improved support for deep relationships among ferns. Taxon 55(4): 897–906. https://doi.org/10.2307/25065684
  • Shu JP, Shang H, Jin DM, Wei HJ, Zhou XL, Liu HM, Gu YF, Wang Y, Wang FG, Shen H, Zhang R, Adjie B, Yan YH (2017) Re-establishment of species from synonymies based on DNA barcoding and phylogenetic analysis using Diplopterygium simulans (Gleicheniaceae) as an example. PLoS ONE 12(3): e0164604. https://doi.org/10.1371/journal.pone.0164604
  • Shu JP, Luo JJ, Wei HJ, Yan YH (2018) Clarifying the taxonomic status of Dryopteris yenpingensis based on materialsfrom the type locality. Zhiwu Xuebao 53: 793–800.
  • Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of three noncoding regions of chloroplast DNA. Plant Molecular Biology 17(5): 1105–1109. https://doi.org/10.1007/BF00037152
  • Tkach N, Röser M, Miehe G, Muellner-Riehl AN, Ebersbach J, Favre A, Hoffmann MH (2015) Molecular phylogenetics, morphology and a revised classification of the complex genus Saxifraga (saxifragaceae). Taxon 64(6): 1159–1187. https://doi.org/10.12705/646.4
  • Wang QX, Dai XL (2010) Spores of Polypodiales (Filicales) from China. Science Press, Beijing.
  • Wang T, Xiao B, Liu ED, Nguyen KS, Duan JQ, Wang KL, Yan YH, Xiang JY (2020) Rediscovery of Angiopteris tonkinensis (Marattiaceae) after 100 years, and its revision. PhytoKeys 161: 1–9. https://doi.org/10.3897/phytokeys.161.54912
  • Wei R, Ebihara A, Zhu YM, Zhao CF, Hennequin S, Zhang XC (2018) A total-evidence phylogeny of the lady fern genus athyriumroth (athyriaceae) with a new infrageneric classification. Molecular Phylogenetics and Evolution 119: 25–36. https://doi.org/10.1016/j.ympev.2017.10.019
  • Wu H, Ching RC (1991) Fern Families and Genera of China. Science Press, Beijing.
  • Xu SX (1993) Vittaria Sm. In: Editorial Committee (Eds) Flora of Jiangxi (Vol. 1 (Vittariaceae)). Jiangxi Science Technology Press Nanchang, China, 345–353.
  • Yan YH, Zhang XC, Zhou XL, Sun JQ (2016) Pteridaceae. Species catalogue of China. Volume 1 Plants. Pteridophytes. Science Press, Beiging, 38–60.
  • Zhang XC (1999) Vittariaceae. In: Chu WM (Ed.) Flora Reipublicae Popularis Sinicae 3. Science Press, Beiging, 12–31.
  • Zhang XC, Gilbert MG (2013) Haplopteris C. Presl. In: WU ZY, Raven PH, Hong DY (Eds) Flora of China (Vol. 2/3 (Pteridaceae)). Science Press, Beijing and Missouri Botanical Garden Press.
  • Zhang D, Gao FL, Li WX, Jakovlić I, Zou H, Zhang J, Wang GT (2018) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. bioRxiv 489088. https://doi.org/10.1101/489088
login to comment