Research Article |
|
Corresponding author: Barbara Gravendeel ( barbara.gravendeel@naturalis.nl ) Academic editor: Lorenzo Peruzzi
© 2015 Bobby P. Sulistyo, Ronny Boos, Jim E. Cootes, Barbara Gravendeel.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Sulistyo B, Boos R, Cootes J, Gravendeel B (2015) Dendrochilum hampelii (Coelogyninae, Epidendroideae, Orchidaceae) traded as ‘Big Pink’ is a new species, not a hybrid: evidence from nrITS, matK and ycf1 sequence data. PhytoKeys 56: 83-97. https://doi.org/10.3897/phytokeys.56.5432
|
In 2013, an unidentified species of Dendrochilum appeared in cultivation under the commercial trade name ‘Big Pink’. Using sequences of the nuclear ribosomal ITS1-5.8S-ITS2 region and of the plastid matK and ycf1 genes, we examined the phylogenetic relationships between ‘Big Pink’ and six other species of the phenetically defined Dendrochilum subgen. Platyclinis sect. Eurybrachium. Separate and combined analyses (using Bayesian, Maximum Likelihood and Parsimony inference) showed consistent placement of the unidentified species within a statistically well supported clade. Furthermore, the multi-copy nrITS marker showed clear distinct peaks. Thus, we found no evidence that ‘Big Pink’ could be a hybrid. Against this background, and further supported by species-specific mutations in (at least) nrITS and ycf1, we formally describe ‘Big Pink’ as a new species under the name Dendrochilum hampelii. Morphologically, it is most similar to D. propinquum, but it differs in a number of characters. Of the two cultivated individuals available for our study, one was of unrecorded provenance. The other allegedly originated from the Philippines. Observations of the species occurring in the wild in the Philippines in the northern provinces of Bukidnon and Misamis Oriental on the island of Mindanao confirmed this.
Dendrochilum hampelii , Molecular Phylogenetics, Orchids, the Philippines
The largely Malesian genus Dendrochilum Blume (
The formal description of new species of unknown natural distribution has undoubtedly served to stimulate the (partly successful) search for these species in the wild, thus demonstrating the relevancy of this practice—not least in a conservation context. Nevertheless, describing new species based on material in commercial trade also involves a few problems. Thus,
Since chloroplast DNA is usually maternally inherited and nuclear DNA is biparentally inherited in orchids, incongruences between nuclear and plastid gene trees might indicate past events of hybridization. For example, by comparing phylogenies based on cpDNA and nrDNA,
This paper reports our study of an unidentified Dendrochilum (trade name: ‘Big Pink’) that appeared in cultivation in 2013. A live plant presented to the Hortus botanicus in Leiden carried a tag indicating a Philippinese provenance. However, as the plant came from a commercial nursery that trades much material of unknown geographic origin, we felt this provenance was in need of verification.
Synanthous inflorescences in combination with an entire rostellum, presence of stelidia and an apical wing on the column place the study plant in the phenetically defined subgenus Platyclinis Engl. as circumscribed by
Altogether, we decided to examine ‘Big Pink’ in a molecular phylogenetic framework—and to describe it as a new species, if the results of the phylogenetic study could reject the possibility of ‘Big Pink’ being a hybrid.
The possible hybrid status of ‘Big Pink’ was tested using a molecular phylogenetic approach based on three markers, namely the biparentally inherited multi-copy nuclear ribosomal internal transcribed spacer (nrITS), and the maternally inherited plastid matK and ycf1 genes. The ingroup consisted of ‘Big Pink’ and six other species belonging to Dendrochilum subgen. Platyclinis sect. Eurybrachium (cf.
List of species sampled for our DNA-based phylogenetic analysis with voucher data. All species in the table belong to the phenetically defined Dendrochilum subgen. Platyclinis sect. Eurybrachium. Abbrevations of herbaria: C=University of Copenhagen, Copenhagen, Denmark; K=Royal Botanic Gardens Kew, United Kingdom; L=Naturalis Biodiversity Center, Leiden, The Netherlands; N=Nanjing University, Nanjing, China.
| Species Voucher |
NCBI GenBank accession numbers | ||
|---|---|---|---|
| nrITS | matK | ycf1 | |
|
Dendrochilum apoense T.Hashim. cult. Hort. Bot. Hafn. s.n. (C!) |
KT334200 | KT334206 | KT334213 |
|
Dendrochilum auriculare Ames cult. Hort. Bot. Hafn. P2012.5172 (C!) |
KT334201 | KT334207 | KT334214 |
|
Dendrochilum coccineum H.A.Pedersen & Gravend. cult. Richard C. Warren, Warren EQ 3060 (C!) |
AY534923 | KT334208 | KT334215 |
|
Dendrochilum convallariiforme Schauer cult. Hort. Bot. Hafn. P2012.5177 (C!) |
KT334202 | KT334209 | KT334216 |
|
cult. Hort. bot. Leiden 20130654 (L! [WAG0116920]]) |
KT334203 | KT334210 | KT334217 |
|
Dendrochilum septemnervium H.A.Pedersen cult. Hort. Bot. Hafn. P2012.5195 (C!) |
KT334204 | KT334211 | KT334218 |
|
Dendrochilum tortile H.A.Pedersen cult. Hort. Bot. Hafn. P2012.5200 (C!) |
KT334205 | KT334212 | KT334219 |
|
Thunia alba (Lindl.) Rchb.f. Nepal, Chase 589 (K!) |
AY008466 | AY121731 | - |
|
Thunia alba (Lindl.) Rchb.f. China, B. Hou EThuA (N!) |
- | - | KF361675 |
A live plant of ‘Big Pink’ was available from the Hortus botanicus in Leiden, whereas the remaining Dendrochilum plants sampled for this study were reared in the Botanical Garden, Natural History Museum of Denmark. For information on vouchers, see Table
Total genomic DNA was obtained from 50 mg of silica dried or fresh leaf tissue. In the case of ‘Big Pink’, the tissue was mechanically reduced to dry powder using liquid nitrogen; for all other taxa, it was ground in Lysing Matrix A tubes (MP Biomedicals) and extracted using the DNeasy Plant Mini Kit (Qiagen) following the manufacturer’s protocol.
The ITS1-5.8S-ITS2 region of the nuclear ribosomal internal transcribed spacer (nrITS) was amplified using primers 17SE (ACGAATTCATGGTCCGGTGAAGTGTTC) and 26SE (TAGAATTCCCCGGTTCGCTCGCCGTTAC), as described by
The primers for the amplification of the chloroplast matK region were also used by
The 3’ end portion of the chloroplast ycf1 region was amplified using primers newly designed in this study. The design was based on the ycf1 sequences data set of
Sanger sequencing of the amplification products was performed at Baseclear (http://www.baseclear.com/), using an ABI 3730xl sequencer (Applied Biosystems). All new sequences are deposited in NCBI GenBank (Table
Raw Sanger sequencing results in the form of AB1 files were edited and contigged using Sequencher 5.3 sequence analysis software (http://www.genecodes.com). The ends of all data sets were trimmed to avoid character misinterpretation. Ambiguous bases were replaced with “N” in the data matrix. The sequences were aligned using Geneious multiple sequence alignment in Geneious 5.6.7 (Kearse et al. 2012) with subsequent manual adjustments. Missing data were replaced with “?”.
Phylogenetic analyses were carried out by means of Maximum Parsimony and Maximum Likelihood using PAUP* and Bayesian methods using the software Bayesian Evolutionary Analysis and Sampling of Trees (BEAST ver. 1.8.0;
The nrITS sequence alignment contained 854 positions with a mean ungapped length of 834 bp. Included in the alignment were the nrITS1 (236 positions), 5.8S RNA (166 positions), and mrITS2 (253 positions) regions. In total, the number of variable sites for the included positions was 164 (19.2%), of which 39 were potentially phylogenetically informative. Mean pairwise distances within the ingroup varied from 0.2–6.9%. There were six synapomorphic indels, with a size ranging from 1–5 bp. All the sequences included in the nrITS matrix were complete except for T. alba, which lacked 110 characters.
The matK matrix was characterized by a fairly high number of missing data, mostly due to amplification failures. Samples lacking approximately half (800 bp) of the entire matK sequence included D. apoense T.Hashim., D. septemnervium H.A.Pedersen and D. tortile H.A.Pedersen. The matK alignment consisted of 1,783 positions, with a mean ungapped length of approximately 1,769 bp. The alignment contained the least variable sites out of the three alignments, 91 sites (5.1%) with 5 potentially phylogenetically informative sites. Mean pairwise distances within the ingroup ranged from 0.8–71.1%. There was a synapomorphic indel of 1 bp.
The ycf1 alignment consisted of 1,297 positions with mean ungapped length of 1065 bp. The number of variable sites was similar to that of nrITS, 244 (18.8%). Out of these positions, 30 were phylogenetically informative. There was one synapomorphic indel with a size of 9 bp. Mean pairwise distances within the ingroup varied from 10–33.5%. Amplification failures for D. septemnervium resulted in almost half of the desired ycf1 marker missing for this species.
The phylogenetic trees based on the combined matK + ycf1 matrix obtained by all three methods yielded overall stronger branch support relative to that of nrITS (Fig.
Phylogenetic relationships amongst the sampled species of Dendrochilum, created using BEAST and PAUP*. The values on the nodes represent posterior probabilities, whereas branch lengths indicate to the relative number of changes: A comparison between topologies based on nrITS and matK + ycf1 matrices B topology resulting from the combined nrITS + matK + ycf1 data matrices.
No hard incongruence was present between the nrITS and the plastid phylogenetic trees obtained by all three methods. The combined nrITS + matK + ycf1 matrix yielded a single tree with highly consistent topology and strong support values; the same clades as those in the separate nrITS and matK + ycf1 analyses were identified (Fig.
Analysis of the nrITS sequence alignment revealed a species-specific mutation of ‘Big Pink’ at position 567 (Fig.
Above: alignment of nrITS sequences of the ingroup species from our phylogenetic analyses. For ‘Big Pink’ (Dendrochilum hampelii) and its apparently closest relatives among our study species, electropherograms are shown in red boxes. The electropherograms show clear distinct peaks; the species-specific mutation of ‘Big Pink’ is indicated by a red arrow. Below: electropherogram of ‘Big Pink’ (Dendrochilum hampelii) covering a larger region of nrITS; the distinct single peaks in both the forward and reverse sequences suggest this is a wild species rather than an artificial hybrid (see text for details).
Nuclear sequence variation found was largely in agreement with previous studies in Coelogyninae (
Genetically, ‘Big Pink’ possessed a number of automorphic mutations compared to the other species included in our small phylogenetic study. These unique mutations were found in nrITS and ycf1, whereas one in matK is in need of verification due to the alignment being characterized by a fairly high number of missing data. Morphologically, ‘Big Pink’ is most similar to D. propinquum Ames. Unfortunately, no material was available of D. propinquum for DNA sequencing for this study. However, ‘Big Pink’ has much larger flowers (approximately twice the size of those of D. propinquum), its flowers have petals that are 1.4–1.5 times as broad as the sepals (0.8–1.1 times in D. propinquum), its labellum is broadly cordate (broadly elliptic to ovate in D. propinquum), and the stelidia of its column are acute (obtuse in D. propinquum). Against this background, we describe ‘Big Pink’ as a new species below.
Contrary to the studies of
Based on these results, it is determined that “Big Pink” is a new species in need of recognition. Formally naming the species is relevant for horticulture and ex situ conservation, because the name provides an unambiguous way to refer to the species.The morphology of ‘Big Pink’ was described using terminology of the vocabulary and list of individual absolute terms in
Sine loco et anno, Perry 490 (holotype L!).
This new species is similar to D. propinquum Ames, but is distinguished by its larger flowers with petals proportionally broader (1.4–1.5×) than the sepals, a broadly cordate labellum (6.8–8.0 × 7.2–7.6 m) and acute stelidia.
Medium-sized, tufted epiphytic herb. Roots appearing from the rhizome, ca. 2.7 mm in diameter. Pseudobulbs tightly clustered on a short rhizome, fusiform, 3.5–5.0 cm long, 0.5–1.4 cm in diameter, longitudinally striated when dry, 1-leaved, initially covered by ca. 3 imperfectly to nearly perfectly tubular, rounded to acute cataphylls that soon disintegrate into persistent fibers. Leaves convolute, dorsiventrally flattened, petiolate; petiole channeled, 3.0–4.5 cm long; lamina (ob)lanceolate, obtuse, 13.0–20.0 × 3.7–5 cm, subcoriaceous, with 7–8 distinct (and many indistinct) nerves. Inflorescence synanthous, racemose; peduncle suberect, arched, slender, somewhat flattened, 18.0–21.2 cm long, sparsely and finely setose; rachis pendent with distichously alternating flowers (but the rachis axis twisted so as to produce a cylindrical inflorescence), many-flowered with internodes of 3–7 mm, somewhat furrowed, 20.0–27.5 cm long, sparsely and finely setose, basally with 1 appressed non-floriferous bract; flowering starting from the proximal part of the rachis. Floral bracts glumaceous, broadly lanceolate to (ovate-)oblong when flattened, obtuse to acute, 4.0–9.5 × 2.2–4.3 mm, entire, 9- to 19-nerved from the base, finely setose on the dorsal side. Flowers non-resupinate, pinkish salmon-coloured (Fig.
Dendrochilum hampelii: A portion of inflorescence of cultivated pinkish salmon-coloured form B habit. Photographs by Lubbert Westra of Hort. bot. Leiden 20130654 (L! [spirit no. WAG0116920]) C portion of inflorescence of pale yellow-coloured form of a plant growing in the wild in the Philippines in the Misamis Oriental province of the island of Mindanao. Photograph by James Cootes.
PHILIPPINES? Sine loco et anno, sine coll./cult. Hort. bot. Leiden 20130654 (L! [spirit no. WAG0116920]).
The specific epiphet honours Georg Hampel, who was one of the first to provide us with study material of the newly described species.
The species occurs in the wild in the Philippines in the northern provinces of Bukidnon and Misamis Oriental on the island of Mindanao (Fig.
The live plant in Leiden flowered in mid-December. Attempts to pollinate flowers of D. hampelii were made using pollinia from the same flower and pollinia from a different flower in the same inflorescence. None of these efforts led to fruit formation. This indicates that D. hampelii is probably self-incompatible, as previously demonstrated for D. longibracteatum Pfitzer (
Although the species occurs in cultivation we as yet know very little about the distribution and abundance of D. hampelii in the wild. As such, we recommend the species to be considered for the Data Deficient category of the IUCN Red List of Threatened Species (
We thank Henrik Æ. Pedersen for his feedback on earlier drafts of this manuscript and Esmee Winkel and Lubbert Westra for preparing the line drawing and part of the photos, respectively, and for allowing us to publish these illustrations. Additionally, we are grateful to Georg Hampel, Malcolm Perry and Koos Wubben for providing plant material and to Gitte Petersen and Charlotte Hansen for providing DNA samples from the Natural History Museum of Denmark. The first author thanks Nelleke Kreike for supervision; Marcel Eurlings, Adam Karremans, Rachel Schwallier, Rogier R. van Vugt, and Jaco Kruizinga for other help that included checking of the English; and journal subject editor Clifford Morden for comments and advices.