Research Article
Print
Research Article
Four new species of Pyropia (Bangiales, Rhodophyta) from the west coast of North America: the Pyropia lanceolata species complex updated
expand article infoSandra C. Lindstrom, Jeffery R. Hughey§, Luis E. Aguilar Rosas|
‡ University of British Columbia, Vancouver, Canada
§ Hartnell College, Salinas, United States of America
| Universidad Autónoma de Baja California, Ensenada, Mexico
Open Access

Abstract

Recent molecular studies indicate that the Pyropia lanceolata species complex on the west coast of North America is more speciose than previously thought. Based on extensive rbcL gene sequencing of representative specimens we recognize seven species in the complex, three of which are newly described: Py. montereyensis sp. nov., Py. columbiensis sp. nov., and Py. protolanceolata sp. nov. The new species are all lanceolate, at least when young, and occur in the upper mid to high intertidal zone primarily in winter and early spring. Pyropia montereyensis and Py. columbiensis are sister taxa that are distributed south and north of Cape Mendocino, respectively, and both occur slightly lower on the shore than Py. lanceolata or Py. pseudolanceolata. Pyropia protolanceolata is known thus far only from Morro Rock and the Monterey Peninsula, California; it occurs basally to the other species in the complex in the molecular phylogeny. A fourth newly described species, Pyropia bajacaliforniensis sp. nov., is more closely related to Py. nereocystis than to species in this complex proper. It is a thin species with undulate margins known only from Moss Landing, Monterey Bay, California, and northern Baja California; it also occurs in the high intertidal in spring. Porphyra mumfordii, a high intertidal winter species that has frequently been confused with species in the Py. lanceolata complex, has now been confirmed to occur from Calvert Island, British Columbia, to Pescadero State Park, California.

Keywords

Bangiales, British Columbia, California, new species, northeast Pacific, Pyropia lanceolata species complex, Pyropia nereocystis, rbcL gene

Introduction

The foliose Bangiales are one of the best-studied groups of marine red algae occurring on the west coast of North America. The first two species to be named from the region were two of the most common, Porphyra perforata J. Agardh (1883) and Porphyra nereocystis C.L. Anderson (Blankinship & Keeler, 1892). Hus (1900, 1902) summarized knowledge of the genus on the Pacific Coast, recognizing eleven species and describing three new forms of Porphyra C. Agardh, the genus to which all foliose Bangiales belonged at the time. One of those new forms, P. perforata f. lanceolata Setchell & Hus in Hus (1900), was erected to accommodate lanceolate forms that were dioecious; this taxon was later raised to specific status in Smith and Hollenberg (1943: 213), who also added two more species of Porphyra to the flora. It was Krishnamurthy (1972) who significantly revised the genus in the region and added seven new species, mostly from Washington State. A summary of knowledge at the time was provided by Conway et al. (1975), with detailed descriptions of Pacific Northwest species of Porphyra with emphasis on British Columbia and Washington State; their work was updated by Garbary et al. (1981).

Studies up to then mostly utilized thallus morphology and the pattern of reproductive cell disposition and division as defining features for species. Mumford and Cole (1977) added chromosome numbers as a useful feature, and Lindstrom and Cole (1990, 1992a, b, c) and Lindstrom (1993) utilized isozymes in addition to morphology, chromosome numbers, biogeography and habitat as characters for separating and recognizing even more species.

The taxonomy of foliose Bangiales entered a new phase with the application of DNA sequencing methods. Lindstrom and Fredericq (2003) sequenced the chloroplast rbcL gene of many West Coast species, and Lindstrom (2008) included numerous additional specimens, indicating the need to describe even more species, as did Kucera and Saunders (2012) utilizing the mitochondrial 5´end of the COI gene. Sequencing also indicated that a wholesale revision of the order was needed (first suggested by Oliveira et al. 1995). This led to a revision of the genera of foliose Bangiales by Sutherland et al. (2011), redefining, resurrecting or creating eight genera of bladed Bangiales. Among these eight genera, four (Boreophyllum S.C. Lindstrom, Fuscifolium S.C. Lindstrom, Porphyra and Pyropia J. Agardh) occur on the west coast of North America, and among these Pyropia is by far the most speciose.

The resurrected genus Pyropia contains a number of clades that are resolved with substantial support, and many of these clades are biogeographically circumscribed (Sutherland et al. 2011). One such clade is the northeast Pacific P. lanceolataP. pseudolanceolata complex, first identified as such by Lindstrom and Cole (1992b), who recognized that a number of species were confused under these names. Members of this clade, like other species of Pyropia, have monostromatic blades. As resolved by Sutherland et al. (2011), this clade contains Pyropia sp. 480, Py. pseudolanceolata (V. Krishnamurthy) S.C. Lindstrom, Py. hiberna (S.C. Lindstrom & K.M. Cole) S.C. Lindstrom, Py. fallax (S.C. Lindstrom & K.M. Cole) S.C. Lindstrom, Py. conwayae (S.C. Lindstrom & K.M. Cole) S.C. Lindstrom, and Pyropia sp. 485, indicating that at least two species are as yet undescribed and suggesting uncertainty over the identity of Py. lanceolata (Setchell & Hus) S.C. Lindstrom.

In the present study, we analyzed rbcL and 18S rRNA (SSU) gene sequences from recently collected specimens belonging to this clade from the west coast of North America extending from Baja California to Alaska. We also include the closely related northeast Pacific species Py. nereocystis and Py. kanakaensis (Mumford) S.C. Lindstrom (Lindstrom 2008, Sutherland et al. 2011), and we analyzed short DNA sequences from the type sheets of P. lanceolata and P. hiberna to resolve their relationship, and to determine whether any of the undescribed species could be the same as one of these species. These new data support the recognition of at least four additional species. Below we discuss these species, their relationships to each other, and the characters that distinguish them.

Materials and methods

Specimens were collected by the authors or by those named in the Acknowledgments (Table 1, Suppl. material 1). Collections were made along the west coast of North America from Baja California, Mexico, to the western tip of the Aleutian Islands, Alaska, between 1992 and 2014. Upon collection, the specimens were damp-dried and then desiccated in silica gel. Pieces or separate specimens were pressed to make herbarium vouchers, which are deposited in UBC or UC. Silica-gel dried specimens were returned to the lab, where they were extracted following the CTAB protocol as implemented by Lindstrom and Fredericq (2003). PCR amplification and sequencing of the rbcL gene was carried out as described in Lindstrom (2008) except that KitoF1 (5’ atgtctcaatccgtagaatca 3’) was used as the forward primer rather than F57. DNA from type material of P. lanceolata and P. hiberna was extracted, amplified and sequenced following the protocol described in Lindstrom et al. (2011), except for using 3X the primer concentration used previously. The type fragments were extracted in a separate laboratory (Hartnell College) and processed employing the precautionary steps proposed by Hughey and Gabrielson (2012). For amplification of type material, primers F625 (5'CTCACAACCATTTATGCGTTGG 3’) and R900 (5'GCGAGAATAAGTTGAGTTACCTG 3’) were cycled together.

Specimens for which the rbcL gene was sequenced in this study and used in the phylogenetic analyses. All herbarium vouchers are deposited in UBC unless noted otherwise. Numbers indicate the total number of specimens with the identical sequence (see Suppl. material 1). Specimens in brackets were included in initial analyses but excluded from the analysis shown in Fig. 1. Specimen P814 in Fig. 1 represents a combination of P814 and P827 (Calvert I., BC, 27 May 2013, K. Hind, SCL 15332, KP904063) to provide a more complete sequence.

Extract Collection site Collection date Collector Collection no. GenBank no. Specimens with identical sequence
Pyropia fallax
[P172 Clover Pt, BC, Canada 27 Apr 2002 S.C. Lindstrom no voucher? EU223056 n=5]
P191 Harling Pt, BC, Canada 25 Apr 2005 S.C. Lindstrom SCL 12565 EU223057 unique
[P225 Akutan Bay, AK, USA 31 Jul 2004 S.C. Lindstrom SCL 11611 EU223064 unique]
P525 Chichagof Hbr, AK, USA 04 Jun 2008 S.C. Lindstrom SCL 13483 KP903917 unique
P544 Surveyor Bay, AK, USA 11 Jun 2008 S.C. Lindstrom SCL 13709 KP903919 n=2
P557 Foster I., BC, Canada 27 May 2009 S.C. Lindstrom SCL 14121 KP903922 n=23
P577 Hallo Bay, AK, USA 03 Jul 2009 M.R. Lindeberg UBC A89044 KP903923 n=10
[P815 Calvert I., BC, Canada 25 May 2013 S.C. Lindstrom SCL 15293 KP903936 n=2]
P820 Calvert I., BC, Canada 26 May 2013 S.C. Lindstrom SCL 15304 KP903940 n=2
P851 Calvert I., BC, Canada 18 Feb 2014 S.C. Lindstrom SCL 15595 KP903948 n=17
Pyropia conwayae
P430 French Beach, BC, Canada 12 Mar 2007 S.C. Lindstrom SCL 13109 EU223044 n=2
[P494 Charleston, OR, USA 04 Apr 2008 S.C. Lindstrom SCL 13303 KP903957 n=2]
P589 Camel Rock, CA, USA 14 Feb 2010 S.C. Lindstrom SCL 14287 KP903961 n=13
Pyropia montereyensis
P603 Fort Bragg, CA, USA 15 Feb 2010 S.C. Lindstrom SCL 14311 KP903964 n=7
P645 N of San Simeon, CA, USA 18 Feb 2010 S.C. Lindstrom SCL 14374 KP903967 n=4
P656 S of Ventura Beach, CA, USA 20 Feb 2010 S.C. Lindstrom SCL 14392 KP903968 unique
P763 Spanish Bay, CA, USA 02 Feb 2012 J.R. Hughey UBC A90632 KP903972 n=4
Pyropia columbiensis
P491 Trinidad St. Beach, CA, USA 12 Apr 2008 F.J. Shaughnessy Frank#1 in HSC KP903982 n=2
P859 Calvert I., BC, Canada 18 Feb 2014 S.C. Lindstrom SCL 15599 KP903999 n=20
Pyropia lanceolata
[P584 Trinidad boat launch ramp, CA, USA 14 Feb 2010 S.C. Lindstrom SCL 14276 KP904008 unique]
P612 Van Damme St. Park, CA, USA 16 Feb 2010 S.C. Lindstrom SCL 14321 KP904024 unique
P625 Bodega Marine Lab, CA, USA 16 Feb 2010 S.C. Lindstrom SCL 14341 KP904029 unique
P638 Pescadero St. Park, CA, USA 17 Feb 2010 S.C. Lindstrom SCL 14365 KP904038 n=39
P641 Pacific Grove, CA, USA 17 Feb 2010 S.C. Lindstrom SCL 14369 KP904039 n=2
Pyropia pseudolanceolata
[P332 Chaichei Islets, AK, USA 20 Apr 1995 S.C. Lindstrom SCL 9104 KP904049 unique]
P351 Dundas I., BC, Canada 19 Apr 2007 S.C. Lindstrom SCL 13136 EU223163 n=7
P411 Sedanka Pt, AK, USA 03 Jun 2005 S.C. Lindstrom SCL 12137 EU223165 unique
P488 Sunset Beach, OR, USA 06 Apr 2008 S.C. Lindstrom SCL 13311 KP904052 n=3
P537 Alaid I., AK, USA 07 Jun 2008 S.C. Lindstrom SCL 13630 KP904056 n=28
Pyropia protolanceolata
P480 Spanish Bay, CA, USA 01 Jan 2008 P.W. Gabrielson PWG 1604 KP904005 same as P797
KP903902 (SSU)
P767 Morro Rock, CA, USA 04 Apr 2012 J.R. Hughey UBC A90634 KP904006 same as P480
KP903909 (SSU)
Pyropia kanakaensis
Pkan Kanaka Bay, WA, USA undated M.J. Wynne MICH AF452431 unique
P132 Baker Beach, CA, USA 25 May 2002 S.C. Lindstrom SCL 11409 EU223098 n=3
P222 Olympic Pen., WA, USA 31 May 2003 S.C. Lindstrom SCL 10932 EU223099 unique
Pyropia bajacaliforniensis
P766 Moss Beach Jetty, CA, USA 30 Apr 2012 J.R. Hughey no voucher? KP904065 same as Pyropia sp. MIG
Pyropia sp. MIG Faro de San Miguel, BC, Mexico WELT A024422 HQ687536 same as P766
Pyropia sp. FAL Saldamando, BC, Mexico 21 May 2002 L.E. Aguilar Rosas & R. Aguilar Rosas WELT A024418 HQ687535 unique
Pyropia sp.
s/n San Carlos Beach Park, CA, USA 05 Jan 2015 J.R. Hughey UC 1966781 KP876025 unique
Pyropia nereocystis
P320 Passage I., AK, USA 30 Jun 2003 M.R. Lindeberg SCL 11215 EU223116 unique
P814 Calvert I., BC, Canada 24 May 2013 S.C. Lindstrom SCL 15280 KP904062 n=6

Sequences of the rbcL gene of Pyropia sp. FAL from Playa Saldamando, Baja California, Mexico, HQ687535, and Pyropia sp. MIG from Faro de San Miguel, Baja California, Mexico, HQ687536, were also included in the analyses because of their close relationship to P. kanakaensis and P. nereocystis (Sutherland et al. 2011) and because of the identity of Pyropia sp. MIG with one of our unknown specimens. We selected two specimens of Pyropia sp. (AB118586 and AB287965) as outgroups based on their close genetic identity to Py. nereocystis using the GenBank blastn algorithm (accessed 06 Sept 2014).

Sequences were aligned using BioEdit version 7.0.9.1 (Hall 1999). Maximum parsimony (MP) analysis was performed using PAUP* 4.0b10 (Swofford 2002) as implemented by Lindstrom and Fredericq (2003). Maximum likelihood (ML) was performed using RAxML 7.2.6 [as implemented on the T-rex website (http://www.trex.uqam.ca/index.php?action=raxml; Stamatakis 2006, Buc et al. 2012)], and data were partitioned by codon position. Bayesian phylogenetic analyses were performed on the Bio-Linux7 platform (Field et al. 2006) with MrBayes 3.2.1 (Huelsenbeck et al. 2001, Ronquist and Huelsenbeck 2003). We followed the MrBayes 3.2 manual, which recommends continuing analyses by increasing the number of generations until the average standard deviation of split frequencies drops below 0.01. All runs were performed using a sample frequency of 10 with two independent analyses. To calculate the Potential Scale Reduction Factor and posterior probabilities, the sump and sumt burn-in values were set to discard 25% of the samples.

Results

Thirty-seven rbcL gene sequences (Table 1) were included in the phylogenetic analyses that generated Fig. 1. Both MP and ML generated the same tree topology, as did Bayesian analysis. Several unique sequences were omitted from the analyses after it was determined that their omission did not alter the topology of the phylogenetic tree. In addition to these sequences, the Suppl. material 1 includes 186 additional specimens that were identical to those in Fig. 1. With AB118586 and AB287965 as outgroup species, three major clades are apparent, the Py. nereocystis clade, the Py. kanakaensis clade and the Py. lanceolata clade (formerly called the P. lanceolataP. pseudolanceolata complex).

Figure 1.

Maximum likelihood tree of the Py. lanceolata complex and close relatives. An asterisk indicates 100% bootstrap support in (left to right) maximum parsimony (nreps=10000) and maximum likelihood (nreps=1000), above the line, and a Bayesian probability of 1.0 below the line. Only bootstrap values >50 and Bayesian probabilities >0.900 are shown.

Within the Py. lanceolata clade, Py. protolanceolata diverges first. This species is sister to Py. pseudolanceolata, then Py. lanceolata, but this order of divergence is without support. The clade is terminated by two pairs of sister taxa, the closely related Py. montereyensis and Py. columbiensis species pair, and the somewhat more distantly related Py. conwayae and Py. fallax pair. Both of these species pairs represent a southern and northern species, as is also the case for Py. lanceolata and Py. pseudolanceolata. For the most closely related pair, Py. montereyensis and Py. columbiensis, the former has to date only been found south of Cape Mendocino whereas the latter has only been collected from Cape Mendocino north; thus these species do not appear to overlap in their distributions. In the case of Py. conwayae and Py. fallax, the species overlap in distribution between southern Vancouver Island and southern Oregon. Of these species pairs, the former pair is more constrained in its distribution, occurring only between southern California and central British Columbia whereas the latter pair extends from central California to at least the westernmost Aleutian Island. For Py. lanceolata and Py. pseudolanceolata, this older species pair shows an even wider area of overlap, between Sitka Sound, AK, and Crescent City, CA. All species in the Py. lanceolata clade occur on strongly supported branches, and all but Py. protolanceolata show some intraspecific variation (to 0.4%) in their rbcL sequences (only two specimens of Py. protolanceolata were sequenced due to the infrequency of collection). The nonoverlapping intraspecific versus interspecific divergence, also referred to as the ‘‘barcode gap’’, allows specimens to be assigned unambiguously to genetic clusters that constitute putative genetic species (Le Gall and Saunders 2010).

In the Py. nereocystis clade, Py. nereocystis is sister to two divergent species. Pyropia sp. has been collected several times in early winter from the uppermost intertidal on the Monterey Peninsula; it is the subject of a separate study and will be described there. Pyropia bajacaliforniensis, the other species, has been collected in late spring on the central California and northern Baja California coasts. The type specimen, described below, diverges from two other collections by 0.3% (4 base pairs); this level of divergence is within the typical species variation exhibited by the rbcL gene in foliose Bangiales of up to 0.4% (Nelson and Broom 2010, Mols-Mortensen et al. 2012) although levels up to 1% have been reported for a few species (Lindstrom 2008).

Pyropia kanakaensis terminates its own long branch, suggesting a long evolutionary history separate from its closest relatives. It also shows significant within species variation.

We also sequenced the 18S rRNA gene in representatives of these species (Table 1, Suppl. material 1) to complement the data in Sutherland et al. (2011). There was relatively little variation among species and little structure to the phylogenetic tree except for weak support for sibling relationships between Py. nereocystis and Py. kanakaensis and between Py. lanceolata and Py. pseudolanceolata.

Characters of the species in the Py. lanceolata clade are summarized in Table 2. Most specimens are lanceolate with slightly undulate margins. All are monostromatic with one chloroplast per cell although chloroplast division prior to cell division can give the appearance of cells being vegetatively diplastidial. Among the species, only Py. fallax is monoecious, with spermatangial patches or streaks among pale red zygotosporangia, which occur in submarginal patches, mottles, streaks or hieroglyphs. The remaining species are almost invariably dioecious, with spermatangia occurring along cream-colored margins and with the red zygotosporangia occurring along the margin and across the distal end of the thallus in patches usually intermixed with vegetative cells, giving the appearance of red hieroglyphs. All species occur on rock, often near sand.

Comparison of morphological features of species in the Pyropia lanceolata clade.

Feature Py. fallax Py. conwayae Py. montereyensis Py. columbiensis Py. lanceolata Py. pseudolanceolata Py. protolanceolata
Shape Ovate to broadly lanceolate Lanceolate Lanceolate, occasionally oblanceolate Lanceolate to somewhat ovate (rarely obovate) Lanceolate Lanceolate to ovate Linear to lanceolate
Thickness 49–66 µm 53–113 µm 50–110 µm 50–115 µm 45–100 µm 65–150 µm 28–65 µm
Width (males) to 5.0 cm 2.0–11.0 cm to 2.3 cm to 5.5 cm 1.2–1.5 cm 1.0–5.4 cm to 1.2 cm
Length (males) to 30 cm to 83 cm to 69 cm to at least 31 cm 10–14 cm to 31 cm to 16 cm
Width (females) same as males 4.0–8.2 cm to 4.8 (10) cm to 12 cm 1.0–3.5 cm 1.8–9.0 cm not seen
Length (females) same as males to 40 cm to 68 cm to at least 28 cm to 43 cm to 34 cm not seen
Color Margin reddish, center greenish Dark gray-green Olive-green to grayish or brownish purple Olive-green to grayish or brownish purple Olive-green, brown (golden), or grayish purple Olive-green to greenish gray or grayish purple Dusky rose
Spermatangia 1–2 × 2–4 × 8 2–4 × 4 × 16 2–4 × 2–4 × 8–16 2–4 × 2–4 × 8 2–4 × 2–4 × 8 2–4 × 2–4 × 8 2 × 2 × 8
Zygotosporangia in tiers of 4–8 2–4 × 2–4 × 2–4 2–4 × 2–4 × 4–8 2–4 × 2–4 × 2–4 2–4 × 2–4 × 4–8 2–4 × 2–4 × 4–8 not seen
Elevation Mid to high intertidal Mid intertidal Mid to high intertidal Mid to high intertidal Upper mid to high intertidal High intertidal Very high intertidal
Phenology Winter to late spring (mid summer in north) Late winter to late spring Winter to mid spring Winter to early spring (rarely to mid summer) Winter to early spring Winter to early spring (mid summer in north) Winter to early spring
Distribution Attu I., AK, to southern OR Tofino, BC, to Land’s End, San Francisco, CA Fort Bragg to just south of Ventura, CA Calvert I., BC, to Cape Mendocino, CA Sitka Sound, AK, to Cambria, CA Attu I., AK, to Crescent City, CA Spanish Bay & Morro Bay, CA
Haploid chromosome number 2 2 unknown unknown 3 3 unknown

Below we describe in detail the previously unnamed species in this clade, as well as a new species in the Py. nereocystis clade.

Pyropia montereyensis S.C. Lindstrom & J.R. Hughey, sp. nov.

Fig. 2

Description

Thalli lanceolate and acuminate (occasionally oblanceolate) when young, becoming ovate to nearly orbiculate and often cleft when post-reproductive, base cuneate to strongly umbilicate when old; 50–75 mm thick when dried and young, 90–110 mm thick when old; males to at least 2.3 cm wide and 69 cm long; females to at least 4.8 cm wide and 68 cm long (although usually narrower; to 10 cm broad when old); color uniform throughout the thallus except for reproductive areas, olive green when fresh, drying to grayish or brownish purple. Thalli dioecious. Spermatangia in packets of 2–4 × 2–4 × 8–16. Zygotosporangia in packets of 2–4 × 2–4 × 4–8. Habitat: mid to high intertidal rock, usually associated with sand. Phenology: Winter to mid spring. Distinguished from other species of Pyropia by unique rbcL and 18S rRNA gene sequences.

Holotype

Saxicolous in the upper intertidal on rocks partially buried in sand at the north end of Spanish Bay, Pacific Grove, California, USA (36°37.16'N 121°56.52'W), Hughey, 02 Feb 2014, UC2050590. GenBank sequence KP903972 (rbcL).

Isotypes

UBC A90632.

Etymology

This species is named for the biogeographic region in which it is found following the boundaries of Croom et al. (1995) more closely than those of Valentine (1966).

Distribution

Fort Bragg to just south of Ventura Beach, California, USA.

We did not obtain an SSU sequence from type material of this species. The SSU sequence in GenBank (KP903907) for this species is from another Monterey Peninsula site: Carmel River State Beach.

Figure 2.

Holotype of Py. montereyensis. North end of Spanish Bay, Pacific Grove, California, USA, Hughey, 02 Feb 2014 (UC2050590).

Pyropia columbiensis S.C. Lindstrom, sp. nov.

Fig. 3

Description

Thalli lanceolate when young, becoming somewhat ovate (rarely obovate) when mature; base cuneate, becoming umbilicate; 50–115 mm thick; males to at least 5.5 cm wide and more than 31 cm long; females to 12 cm wide and more than 28 cm long, but thalli mostly narrower; color uniform throughout the thallus except for reproductive areas, olive-green when fresh, drying to grayish or brownish purple. Thalli dioecious. Spermatangia in packets of 2–4 × 2–4 × 8. Mature zygotosporangia in packets of 2–4 × 2–4 × 2–4. Habitat: mid to high intertidal rock, usually associated with sand. Phenology: winter to early spring (a few thalli may persist as late as mid summer). Distinguished from other species of Pyropia by unique rbcL and 18S rRNA gene sequences.

Holotype

Saxicolous in the upper mid intertidal on rocks partially buried in sand at the south end of West Beach, Calvert Island, British Columbia, Canada (51°39.14'N 128°08.42'W), S.C. Lindstrom 15596, 18 Feb 2014, UBC A90636. GenBank sequences KP903995, KP903996 (rbcL), KP903910 (SSU).

Isotypes

SCL 15594 (UC 2050591), SCL 15599 (UBC A90637), SCL 15600 & 15601 (UBC A90638).

Etymology

This species is named for the biogeographic region in which it is found, using the terminology of Valentine (1966), but with a modification of the boundaries to extend from Cape Mendocino, California, to the central coast of British Columbia. It also commemorates the centenary of the University of British Columbia herbarium, which was established in early 1916.

Distribution

Calvert Island, British Columbia, Canada, to Cape Mendocino, California, USA.

Pyropia montereyensis and Py. columbiensis are essentially morphologically identical and represent the southern and northern species of a vicariant pair, respectively.

Figure 3.

Holotype of Py. columbiensis. South end of West Beach, Calvert Island, British Columbia, Canada, S.C. Lindstrom 15596, 18 Feb 2014, UBC A90636.

Pyropia protolanceolata S.C. Lindstrom & J.R. Hughey, sp. nov.

Fig. 4

Description

Thalli linear to lanceolate, base cuneate; 28–65 mm thick; to 1.2 cm wide and 16 cm long; color uniform throughout the thallus except for reproductive areas: dusky rose. Thalli dioecious. Spermatangia in packets 2 × 2 × 8. Zygotosporangial thalli not observed Habitat: very high intertidal, above Py. lanceolata and Py. montereyensis when they co-occur. Phenology: Winter to early spring. Distinguished from other species of Pyropia by unique rbcL and 18S rRNA gene sequences.

Holotype

Saxicolous in the uppermost intertidal, above Pyropia lanceolata, northeast side of Morro Rock, Morro Bay, California, USA (35°22.29'N 120°51.98'W), J.R. Hughey, 04 Apr 2012, UBC A90634. GenBank sequences KP904006 (rbcL), KP903909 (SSU).

Etymology

This species is named for its basal position in the phylogeny of the Py. lanceolata complex.

Distribution

Thus far known only from Spanish Bay, Monterey Peninsula, and northeast side of Morro Rock, Morro Bay, California, USA.

Figure 4.

Holotype of Py. protolanceolata. Northeast side of Morro Rock, Morro Bay, California, USA, J.R. Hughey, 04 Apr 2012, UBC A90634.

Pyropia bajacaliforniensis L.E. Aguilar Rosas & J.R. Hughey, sp. nov.

Fig. 5

Description

Thalli broadly lanceolate to ovate, sometimes irregularly lobed, base becoming cordate with age; 45–115 mm thick; 1–5 cm wide to at least 15 cm long; monostromatic, with one or two chloroplasts per cell; margin ruffled, often irregular in outline; color pale dusky pink (in California) or lilac gray (Baja California). Monoecious. Spermatangial packets 4 × 4 × 8, cream-colored, variable in shape, mostly marginal in distal portion of thalli but sometimes forming submarginal streaks. Zygotosporangial packets 2–4 × 2–4 × 2–4, appearing as small pinkish speckles because of intermixing of reproductive and vegetative cells. Habitat: upper intertidal rock. Phenology: late winter to late spring. Distinguished from other species of Pyropia by unique rbcL and 18S rRNA gene sequences.

Holotype

Upper intertidal rock, Playa Saldamando, Baja California, Mexico (31°55.60'N 116°45.30'W), L.E. Aguilar Rosas & R. Aguilar Rosas 764, 21 May 2002, UC 1966778. GenBank sequences HQ687535 (rbcL), DQ084424, DQ084425 (SSU).

Isotypes

UC 1966778, UBC A90700.

Etymology

The specific epithet refers to the provenance of the type material, where it is especially abundant in spring.

Distribution

Moss Landing, California, USA; Playa Saldamando and Faro de San Miguel, Baja California, Mexico.

Figure 5.

Holotype of Py. bajacaliforniensis. Playa Saldamando, Baja California, Mexico, L.E. Aguilar Rosas & R. Aguilar Rosas 764, 21 May 2002, UC 1966778. Scale bar 2.5 cm.

Discussion

Molecular phylogenetic analysis of the foliose Bangiales indicates that Pyropia is the most speciose genus in the order; it also displays the most morphological variation and the widest geographical distribution. Still, there are many geographically restricted clades (Fig. 1, Sutherland et al. 2011). This indicates that much speciation in the order has occurred in particular geographical regions. The Py. lanceolata clade and its close relatives (Py. kanakaensis, the Py. nereocystis clade) are an example of a geographically restricted clade, with species known thus far only from the northeast Pacific, from Baja California, Mexico, to the Aleutian Islands, Alaska. Several of the species are highly restricted geographically: Py. bajacaliforniensis (in the related Py. nereocystis clade) is known only from the Moss Landing area of Monterey Bay, CA, and northern Pacific Baja California. Other species are limited to particular areas of coastal California: Py. protolanceolata thus far known only from Morro Bay and Spanish Bay, California, and Py. montereyensis from southern to northern California south of Cape Mendocino. In contrast, Py. lanceolata and especially Py. pseudolanceolata are widely distributed, occurring from California to Alaska although Py. lanceolata is replaced by Py. pseudolanceolata at many sites from British Columbia north. As with all geographic records, these are based on collections to date and are subject to revision due to both more intense collecting efforts in the region as well as changes in distributions due to changing environmental conditions.

The phylogeny of this group of related species suggests a number of patterns that have occurred in the evolution of some of the species. For example, the diplastidial condition in vegetative cells of Py. kanakaensis has also been observed in species in the Py. lanceolata complex (Smith and Hollenberg 1943, Lindstrom and Cole 1992b), where division of the chloroplast seems to precede by days or even weeks cell division associated with reproductive cell formation. In species of the Py. lanceolata clade, the two chloroplasts remain close together (Smith and Hollenberg 1943, Fig. 10) whereas they move to opposite ends of the cell in Py. kanakaensis (Mumford 1973).

Although the habitat of Py. nereocystis as an obligate epiphyte on the kelp Nereocystis is unique, and Py. kanakaensis occurs primarily in the lower mid intertidal, the remaining species have adapted to the rigors of the mid to high intertidal. In the Py. lanceolata clade proper, Py. lanceolata, Py. pseudolanceolata, and Py. protolanceolata are mostly restricted to the high intertidal and are among the highest-occurring species of seaweeds, as are Py. bajacaliforniensis and Pyropia sp. in the Py. nereocystis clade. Pyropia fallax can occur in the high intertidal but also extends into the mid intertidal, where its sister taxon, Py. conwayae, is found. Where they co-occur, Py. conwayae usually occurs at a slightly lower elevation than Py. lanceolata. Pyropia columbiensis and Py. montereyensis also occur primarily in the upper mid to high intertidal although perhaps not as high as Py. lanceolata and others. Exact elevation of occurrence depends on many factors such as wave exposure, direction the rock is facing as well as season and latitude (and longitude for northern populations). Although thalli can be common on bedrock, when that is the predominant habitat in an area, all of the species can also be abundant on rock protruding from wave-swept sandy shores.

Whereas Py. bajacaliforniensis and Py. kanakaensis are spring and spring-summer species, respectively (appearing on the shore ~April, disappearing in June in the case of the former, and persisting as late as November for the latter), the remaining species, including Py. nereocystis, appear to be winter-spring species, reaching their peak abundance from February to April, and then depending on the species and the location, disappearing from the shore from April to August or later (these later dates occurring for populations near the northern limits of the species).

Because of their similar morphologies, habitats, seasonalities and overlapping distributions, species in this complex have been frequently confused. Much of what has been published on Py. pseudolanceolata in particular has actually applied to different species. For example, the haploid chromosome number reported by Mumford and Cole (1977) for this species was actually for Porphyra mumfordii, and the culture conditions for conchocelis growth and maturation reported by Waaland et al. (1990) were probably for Py. conwayae. Moreover, the rbcL sequence reported for this species by Lindstrom and Fredericq (2003) was that of Py. lanceolata, as were the culture conditions reported for conchospore release (Lindstrom et al. 2008).

There have also been problems with the identity of Pyropia lanceolata. Krishnamurthy (1972) lectotypified Porphyra perforata f. lanceolata, the basionym of Porphyra lanceolata, with UC 95720 (collected by Setchell in Carmel Bay, California on 11 Jan 1899), but Lindstrom and Cole (1992b) felt that the specimens on the sheet did not accord with Smith’s description or with the major portion of Setchell & Hus’ description. They therefore designated MO 24356 in UC (Lindstrom and Cole 1992b, Fig. 8), collected by H.T.A. Hus at Land’s End, San Francisco, California, as lectotype since that collection better fit with the original description. The latter contains two outer specimens that are linear in habit, and four inner specimens that are lanceolate. Since modern DNA methods allow the sequencing of historic material, we sequenced a 251 bp region of the rbcL gene for the two outer and two inner specimens on MO 24356, a single specimen on UC 95720 (https://ucjeps.cspace.berkeley.edu/ucjeps_project/imageserver/blobs/c68a16ad-5ba5-4c15-8d8d/derivatives/OriginalJpeg/content), which all showed a similar morphology, as well as five of the six specimens on the type sheet of Py. hiberna (UBC A80269: http://bridge.botany.ubc.ca/herbarium/details.php?db=ubcalgae.fmp12&layout=ubcalgae_web_details&recid=210219&ass_num=A80269), a species closely related if not identical to Py. lanceolata (Sutherland et al. 2011). Seven of the specimens fell within the variation observed for contemporary collections of Py. lanceolata (Table 3). Specifically, UC 95720 from Carmel Bay, Monterey Peninsula, and four of the UBC A80269 specimens, all from Pacific Grove, Monterey Peninsula, had sequences identical to the two contemporary specimens from Pacific Grove. The contemporary Monterey Peninsula specimens differed from specimens of Py. lanceolata from other geographical regions by 0.3%, an amount insufficient to recognize them as a separate species. The distinctness of Monterey Peninsula genotypes within a species has been observed for other organisms (e.g., Mastocarpus papillatus (C. Agardh) Kützing, Lindstrom et al. 2011). The two identical inner specimens (one female and one male) on the lectotype sheet of MO 24356 from Land’s End differed by 2 bp from the five Monterey Peninsula specimens noted above, but were identical to other Py. lanceolata specimens from outside of the Monterey Peninsula. In contrast, the two outer specimens on the same sheet (female far left and male far right) differed from these two inner specimens by 5 bp over the 251 bp region (but by only 3 bp from Monterey Peninsula Py. lanceolata and by only 2 bp from all Py. conwayae sequenced). Thus, at this time, we are unable to assign a name to the two outer linear specimens on the sheet of MO 24356. Since MO 24356 is heterotypic, we therefore narrow the lectotypification of MO 24356 to the middle four specimens. Our results also confirm that Py. hiberna S.C. Lindstrom & K.M. Cole, 1992: 435 is a heterotypic synonym of Py. lanceolata. The fifth specimen on the type sheet of Py. hiberna did not match among any described foliose Bangiales sequences but did match a recent collection we recognize here as Pyropia sp. (to be described later in a separate paper). Pyropia lanceolata was identified as Unknown #3 in Lindstrom (2008).

Details of sequences of type material (specimen identifier, collection site, collection date, collector, type status, GenBank accession number, and current identification). All sequences represent positions 655–905 in the 1467-bp long rbcL gene.

Specimen Collection site Collection date Collector Type Status GenBank accession no. Current identification
UC95720 Carmel Bay, CA 11 Jan 1899 W.A. Setchell Krishnamurthy (1972) lectotype of P. lanceolata KP904067 Py. lanceolata
UBC A80269 leftmost Pacific Grove, CA 29 Dec 1990 S.C. Lindstrom Holotype of P. hiberna KP904068 Py. lanceolata
UBC A80269 third from left Pacific Grove, CA 29 Dec 1990 S.C. Lindstrom Holotype of P. hiberna KP904069 Py. lanceolata
UBC A80269 third from right Pacific Grove, CA 29 Dec 1990 S.C. Lindstrom Holotype of P. hiberna KP904070 Py. lanceolata
UBC A80269 second from right Pacific Grove, CA 29 Dec 1990 S.C. Lindstrom Holotype of P. hiberna KP904071 Py. lanceolata
MO24356 in UC center male Land`s End, San Francisco, CA 08 Feb 1899 H. Hus Lindstrom and Cole (1992b) lectotype of P. lanceolata KP904072 Py. lanceolata
MO24356 in UC center female Land`s End, San Francisco, CA 08 Feb 1899 H. Hus Lindstrom and Cole (1992b) lectotype of P. lanceolata KP904073 Py. lanceolata
UBC A80269 second from left Pacific Grove, CA 29 Dec 1990 S.C. Lindstrom Holotype of P. hiberna KP904074 Pyropia sp.
MO24356 in UC left male Land`s End, San Francisco, CA 08 Feb 1899 H. Hus Lindstrom and Cole (1992b) lectotype of P. lanceolata KP904075 probably Py. conwayae or Py. lanceolata
MO24356 in UC right female Land`s End, San Francisco, CA 08 Feb 1899 H. Hus Lindstrom and Cole (1992b) lectotype of P. lanceolata KP904076 probably Py. conwayae or Py. lanceolata

In the earlier paper on the Py. lanceolata complex (Lindstrom and Cole 1992b), they included Porphyra mumfordii as one of the species. This was in part because this entity had previously been misidentified as P. pseudolanceolata (Conway et al. 1975, Mumford and Cole 1977). Subsequent DNA sequencing studies have shown that these species are unrelated (Lindstrom and Fredericq 2003, Lindstrom 2008), despite the fact that P. mumfordii continues to be easily confused with species in the Py. lanceolata complex in the field because of similar habitat, seasonality and habit (see Lindstrom and Cole 1992b for a detailed comparison of these species). In conjunction with the present study, we have extended the range of P. mumfordii south to Pescadero State Park, California, and north to Calvert Island, British Columbia (Suppl. material 1).

As noted above, the species in the Py. lanceolata clade show little morphological differentiation. Therefore, the following key to species in this clade relies heavily on geographic distribution and on modest differences in seasonality and elevation on the shore.

1 Blade oblong or lanceolate, monoecious, sexes intermixed on thalli Py. fallax
Blade ovate or lanceolate, usually dioecious, if monoecious, sectored 2
2 Mid to upper mid intertidal, often associated with sand, in late winter and spring 3
High intertidal to supralittoral, usually on bedrock, winter to very early spring 5
3 Mid intertidal, from Land’s End, San Francisco, California, to Tofino, British Columbia, but most common on the Oregon coast and along the Strait of Juan de Fuca Py. conwayae
Mid to upper mid intertidal, common on exposed coastlines 4
4 Known from Cape Mendocino north in California and on Calvert Island, central coast of British Columbia Py. columbiensis
Known from just south of Ventura Beach north to the Monterey Peninsula and from Fort Bragg, California Py. montereyensis
5 Known only from Spanish Bay, Monterey Peninsula, and northeast of Morro Rock, Morro Bay, California Py. protolanceolata
Widely distributed from California to Alaska 6
6. Common high intertidal winter species in California (isolated populations at Whiffen Spit and Calvert I., BC, and Sitka Sound, AK) Py. lanceolata
Common high intertidal winter species from Oregon to Alaska Py. pseudolanceolata

Acknowledgements

The following people kindly provided or helped obtain modern specimens that were used in this study: Simona Augyte, Don Canestro, Perry Canfield, John Cubit, Paul Gabrielson, Jochen Halfar, Gayle Hansen, Jon Houghton, Emily Jones, Denis Kushnirak, Mandy Lindeberg, Patrick Martone, Christina Munck, Eric Peterson, Susan Saupe, Frank Shaughnessy, Kathrine Springman, and Paul Tate. Kathy Ann Miller kindly provided the snippets of type material of P. lanceolata that were analyzed in this study. Expenses associated with DNA sequencing were defrayed by funding from the Natural Sciences and Engineering Research Council of Canada (NSERCC), the Census of Marine Life, Emilie D. Lindstrom, the Tula Foundation, and a private family trust from Paul W. Gabrielson. NSERCC and the Tula Foundation subsidized collection trips. The help of all is greatly appreciated.

References

  • Agardh JG (1883) Till algernes systematik. Nya bidrag. (Tredje afdelningen.). Lunds Universitets Års-Skrift, Afdelningen for Mathematik och Naturvetenskap 9(2): 1–177 + 4 plates.
  • Blankinship JW, Keeler CA (1892) On the natural history of the Farallon Islands. Zoe 3: 144–165.
  • Buc A, Diallo AB, Makarenkov V (2012) T-REX: a web server for inferring, validating and visualizing phylogenetic trees and networks. Nucleic Acid Research 40(W1): W573–W579. doi: 10.1093/nar/gks485
  • Conway E, Mumford TF Jr, Scagel RF (1975) The genus Porphyra in British Columbia and Washington. Syesis 8: 185–244.
  • Croom M, Wolotira R, Henwood W (1995) Marine Region 15: Northeast Pacific. A global representative system of marine protected areas. Vol. 4. Great Barrier Reef Marine Park Authority, The World Bank, The World Conservation Union (IUCN), Washington, D.C., 55–107.
  • Field D, Tiwari B, Booth T, Houten S, Swan D, Bertrand N, Thurston M (2006) Open software for biologists: from famine to feast. Nature Biotechnology 24: 801–803. doi: 10.1038/nbt0706-801
  • Garbary DJ, Hansen GI, Scagel RF (1980) The marine algae of British Columbia and northern Washington: Division Rhodophyta (red algae), Class Bangiophyceae. Syesis 13: 137–195.
  • Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP (2001) Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294: 2310–2314. doi: 10.1126/science.1065889
  • Hughey JR, Gabrielson PG (2012) Comment on “Acquiring DNA sequence data from dried archival red algae (Florideophyceae) for the purpose of applying available names to contemporary genetic species: a critical assessment”. Botany 90: 191–203. doi: 10.1139/b2012-102
  • Hus HTA (1900) Preliminary notes on west-coast Porphyra s. Zoe 5: 61–70.
  • Hus HTA (1902) An account of the species of Porphyra found on the Pacific coast of North America. Proceedings of the California Academy of Sciences, Ser. 3, Botany 2: 173–241.
  • Krishnamurthy V (1972) A revision of the species of the algal genus Porphyra occurring on the Pacific coast of North America. Pacific Science 26: 24–49.
  • Kucera H, Saunders GW (2012) A survey of Bangiales (Rhodophyta) based on multiple molecular markers reveals cryptic diversity. Journal of Phycology 48: 869–882. doi: 10.1111/j.1529-8817.2012.01193.x
  • Le Gall L, Saunders GW (2010) DNA barcoding is a powerful tool to uncover algal diversity: a case study of the Phyllophoraceae (Gigartinales, Rhodophyta) in the Canadian flora. Journal of Phycology 46: 374–389. doi: 10.1111/j.1529-8817.2010.00807.x
  • Lindstrom SC (1993) Intraspecific and interspecific genetic variation in species of Porphyra (Rhodophyta, Bangiales) from British Columbia and adjacent waters. Journal of Applied Phycology 5: 53–62. doi: 10.1007/BF02182422
  • Lindstrom SC (2008) Cryptic diversity, biogeography and genetic variation in Northeast Pacific species of Porphyra sensu lato (Bangiales, Rhodophyta). Journal of Applied Phycology 20: 951–962. doi: 10.1007/s10811-008-9313-9
  • Lindstrom SC, Cole KM (1990) Porphyra fallax, a new species of Rhodophyta from British Columbia and northern Washington. Japanese Journal of Phycology 38(4): 371–376.
  • Lindstrom SC, Cole KM (1992a) Relationships between some North Atlantic and North Pacific species of Porphyra (Bangiales, Rhodophyta): evidence from isozymes, morphology, and chromosomes. Canadian Journal of Botany 70(7): 1355–1363. doi: 10.1139/b92-170
  • Lindstrom SC, Cole KM (1992b) The Porphyra lanceolata-P. pseudolanceolata (Bangiales, Rhodophyta) complex unmasked: recognition of new species based on isozymes, morphology, chromosomes and distributions. Phycologia 31(5): 431–448. doi: 10.2216/i0031-8884-31-5-431.1
  • Lindstrom SC, Cole KM (1992c) A revision of the species of Porphyra (Rhodophyta: Bangiales) occurring in British Columbia and adjacent waters. Canadian Journal of Botany 70(10): 2066–2075. doi: 10.1139/b92-256
  • Lindstrom SC, Fredericq S (2003) rbcL gene sequences reveal relationships among north-east Pacific species of Porphyra (Bangiales, Rhodophyta) and a new species, P. aestivalis. Phycological Research 51(3): 211–224. doi: 10.1111/j.1440-1835.2003.tb00189.x
  • Lindstrom SC, Conitz JM, Hall S, Stekoll MS (2008) Induction of conchospore release: ecotypic variation in northeast Pacific species of Porphyra. Journal of Applied Phycology 20: 331–340. doi: 10.1007/s10811-007-9261-9
  • Lindstrom SC, Hughey JR, Martone PT (2011) New, resurrected and redefined species of Mastocarpus (Phyllophoraceae, Rhodophyta) from the northeast Pacific. Phycologia 50(6): 661–683. doi: 10.2216/10-38.1
  • Mols-Mortensen A, Neefus CD, Nielsen R, Gunnarsson K, Egilsdóttir S, Pedersen PM, Brodie J (2012) New insights into the biodiversity and genetic relationships of foliose Bangiales (Rhodophyta) in Iceland and the Faroe Islands. European Journal of Phycology 47(2): 146–159. doi: 10.1080/09670262.2012.666678
  • Mumford TF Jr (1973) A new species of Porphyra from the west coast of North America. Syesis 6: 239–242.
  • Mumford TF Jr, Cole KM (1977) Chromosome numbers for fifteen species in the genus Porphyra (Bangiales, Rhodophyta) from the west coast of North America. Phycologia 16(4): 373–377. doi: 10.2216/i0031-8884-16-4-373.1
  • Nelson WA, Broom JES (2010) The identity of Porphyra columbina (Bangiales, Rhodophyta) originally described from the New Zealand subantarctic islands. Australian Systematic Botany 23: 16–26. doi: 10.1071/SB09032
  • Oliveira MC, Kurniawan J, Bird CJ, Rice EL, Murphy CA, Singh RK, Gutell RR, Ragan MA (1995) A preliminary investigation of the order Bangiales (Bangiophycidae, Rhodophyta) based on sequences of nuclear small-subunit ribosomal RNA genes. Phycological Research 43(2): 71–79. doi: 10.1111/j.1440-1835.1995.tb00007.x
  • Ronquist F, Huelsenbeck JP (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. doi: 10.1093/bioinformatics/btg180
  • Smith GM, Hollenberg GJ (1943) On some Rhodophyceae from the Monterey Peninsula, California. American Journal of Botany 30: 211–222. doi: 10.2307/2437242
  • Stamatakis A (2006) RAxML-VI-HPC: maximum-likelihood based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688–2690. doi: 10.1093/bioinformatics/btl446
  • Sutherland JE, Lindstrom SC, Nelson WA, Brodie J, Lynch MDJ, Hwang MS, Choi H-G, Miyata M, Kikuchi N, Oliveira MC, Farr T, Neefus C, Mols-Mortensen A, Milstein D, Müller KM (2011) A new look at an ancient order: generic revision of the Bangiales (Rhodophyta). Journal of Phycology 47: 1131–1151. doi: 10.1111/j.1529-8817.2011.01052.x
  • Swofford D (2002) PAUP*: Phylogenetic Analysis Using Parsimony (*and Other Methods), Version 4.0b20. Sinauer Associates, Sunderland, MA.
  • Valentine JW (1966) Numerical analysis of marine molluscan ranges on the extratropical northeastern Pacific shelf. Limnology and Oceanography 11: 198–211. doi: 10.4319/lo.1966.11.2.0198
  • Waaland JR, Dickson LG, Duffield ECS (1990) Conchospore production and seasonal occurrence of some Porphyra species (Bangiales, Rhodophyta) in Washington State. Hydrobiologia 204/205: 453–459. doi: 10.1007/BF00040270