Research Article
Print
Research Article
Sedum lipingense (Crassulaceae) identifying a new stonecrop species in SE Guizhou, China, based on morphological and molecular evidence
expand article infoRen-Bo Zhang‡, Tan Deng‡, Quan-Li Dou‡, Lin He‡, Xin-Yun Lv‡, Hong Jiang‡
‡ Zunyi Normal College, Zunyi, China

Corresponding author: Ren-Bo Zhang ( ddzrb@126.com )

Academic editor: Hanno Schaefer
© 2019 Ren-Bo Zhang, Tan Deng, Quan-Li Dou, Lin He, Xin-Yun Lv, Hong Jiang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Zhang R-B, Deng T, Dou Q-L, He L, Lv X-Y, Jiang H (2019) Sedum lipingense (Crassulaceae) identifying a new stonecrop species in SE Guizhou, China, based on morphological and molecular evidence. PhytoKeys 134: 125-133. https://doi.org/10.3897/phytokeys.134.38287
Open Access

Abstract

We describe and illustrate Sedum lipingense (Crassulaceae), a new species of stonecrop found in the limestone areas of SE Guizhou, China. Based on the presence of adaxially gibbous carpels and follicles, this taxon belongs to sect. Sedum S.H. Fu. The new species superficially resembles S. subtile Miquel and S. bulbiferum Makino but differs from these two taxa in its development of a basal leaf rosette during florescence. The nrDNA internal transcribed spacer (ITS) sequences also support the claim that this plant is a new species in the Sedum genus.

Keywords

flora of Guizhou, karst, limestone flora, new taxon, Sedum lipingense

Introduction

Sedum Linnaeus is the largest genus in the Crassulaceae family, containing about 430 species, with the greatest diversity centering in eastern Asia (Thiede and Eggli 2007, Ito et al. 2017a). Approximately 121 Sedum species (91 endemics) occur in China, and 49 of these species (34 endemics) belong to sect. Sedum, a subclass which possess adaxially gibbous carpels and follicles (Wu et al. 2013). There are 23 species within five genera of Crassulaceae found in the Guizhou Province (Li et al. 1985). From 2005, a number of new species of Sedum were reported across mainland China, in areas including Zhejiang (Wang et al. 2005, Jin et al. 2010, 2013), Anhui (Xie et al. 2014, Chen et al. 2017) and the Guizhou Province (Yang et al. 2012). In China, only a few species in this genus retain rosette leaves during florescence, such as S. balfourii Hamet and S. drymarioides var. saxifragiforme X. F. Jin & H. W. Zhang. Sedum balfourii was formerly placed in sect. Aizoon, within the genus Sedum (Fu and Fu 1984), but was then moved to the genus Ohbaea (Raymond-Hamet) V. V. Byalt & I. V. Sokolova (Fu and Ohba 2001) based on its conspicuous lateral flowering stems that derive from rosettes during florescence.

During our fieldwork, a new species of Sedum was discovered in Liping County, Qiandongnan Prefecture, Guizhou Province, China. This particular species has conspicuous rosettes during florescence, an attribute similar to O. balfourii. However, the new species differs from O. balfourii as it possesses central flowering stems rather than lateral ones (Fig. 2D). It also differs from S. drymarioides var. saxifragiforme, a species which is glandular-pubescent throughout, despite its rosette leaves. Based on its adaxially gibbous carpels, we place the new species in Sect. Sedum. Macro-morphological character studies indicated that this species is also somewhat similar to S. subtile Miquel and S. bulbiferum Makino, sharing a number of traits with these species, including opposite leaves on proximal stems and alternate leaves mainly on distal stems. We conducted morphological comparisons and molecular phylogenetic analysis to elucidate the presumed new Sedum species.

Materials and methods

All morphological characters were measured using dissecting microscopes. Specimen checking was done at PE, IBK, ZY, with the additional use of some web database, including the Plant Photo Bank of China (http://ppbc.iplant.cn/) and Global Plants (http://plants.jstor.org/).

Leaf material from the presumed new species was collected in the field, and immediately dried in silica gel for DNA extraction. The nuclear ribosomal internal transcribed spacer (ITS) regions were used as molecular markers. ITS-F (TGAACCTGCGGAAGGATCAT) and ITS-R (GGTAGTCCCGCCTGACCTG) primers (Wu et al. 2013) were selected to amplify the ITS sequences. DNA extraction and PCR amplification of the new species followed the procedure of Wu et al. (2013). Primer synthesis and PCR product sequencing were carried out at the Shanghai Sangon Biotech Institute, China.

The ITS sequence of the new species, as well as the ITS sequences of the congeners downloaded from GeneBank (Table 1), were aligned using MEGA7 and then manually adjusted. Bayesian inference was implemented using MrBayes v3.2.6. Prior to the Bayesian analysis, the Akaike information criterion (AIC) implemented in mrModelTest v1.0 was used to select the best-fit model (GTR+I+G) of molecular evolution. For the BI analyses, four Markov Chain Monte Carlo (MCMC) chains were run, sampling one tree every 100 generations for 2,000,000 generations starting with a random tree (Xie et al. 2014). When the log-likelihood scores were found to have stabilized, a consensus tree was calculated after omitting 5,000 sampled trees as burn-in. Aeonium lancerottense, A. viscatum and Greenovia aizoon were selected as the outgroups referring to Ito et al. (2017b).

Table 1.
Download as
CSV
XLSX

Accession information relating to internal transcribed spacer (ITS) sequences downloaded from GeneBank.

Species Voucher Accession no.
Aeonium lancerottense MEM 1518 AY082143
Aeonium viscatum MEM 1432 AY082154
Greenovia aizoon MEM 1425 AY082112
Sedum alfredii WUK415208 FJ919953
Sedum baileyi LBG0064555 FJ919935
Sedum bergeri Ni et al. AY352897
Sedum bulbiferum_416 Ito416 LC229234
Sedum bulbiferum_hs41 130514hs41 KM111166
Sedum bulbiferum_qz09 130524qz09 KM111165
Sedum emarginatum 130512hs27 KM111145
Sedum erici-magnusii Ito 2077 LC229235
Sedum erythrospermum Tsutsumi 504 AB906473
Sedum formosanum Ito 1260 LC229279
Sedum hakonense S. Mayuzumi C00005 AB088625
Sedum hangzhouense Ito2604 (TNS) LC260130
Sedum japonicum Kokubugata 16749 AB906475
Sedum jiulungshanense CMQ20150076 LC229243
Sedum kiangnanense Ito 1030 LC229244
Sedum lineare Mayuzumi C00120 AB088623
Sedum lipingense ZRB1479 MN150061
Sedum lungtsuanense Ito3563 LC260131
Sedum makinoi Kokubugata 16730 AB906476
Sedum mexicanum Ito 647 LC229247
Sedum morrisonense Ito2765 LC229290
Sedum multicaule Miyamoto et al. TI9596136 AB088631
Sedum nagasakianum Ito2064 LC229249
Sedum nokoense Kokubugata 10426 AB906478
Sedum oligospermum CMQ 74 LC229250
Sedum oreades G. Y. Rao 090803-03 KF113733
Sedum polytrichoides CMQ1057 LC229251
Sedum rupifragum Ito 2070 LC229254
Sedum sarmentosum Ito 978 LC229255
Sedum satumense Ito2295 LC229256
Sedum trullipetalum 9420132 AB088630
Sedum subtile_1999 A. Shimizu 1999 AB088622
Sedum subtile_2259 Ito2259 LC229257
Sedum subtile_624 Ito 624 AB930277
Sedum taiwanianum Ito2770 LC229297
Sedum tetractinum Ito3623 LC260135
Sedum tianmushanense LP 67 LC229261
Sedum tosaense Kokubugata 16726 AB906483
Sedum triactina 9596091 AB088629
Sedum tricarpum Ito 2269 LC229259
Sedum trullipetalum Miyamoto et al.9420132 AB088630
Sedum truncastigmum Ito3254 LC229306
Sedum yabeanum S. Mayuzumi C00029 AB088626
Sedum zentaro-tashiroi H. Ohba 1998 AB088619

Results

Molecular analyses

In this study, the sequences of 40 species (44 samples) were treated as ingroups. Sequence length was 584 bp for the ITS region, of which 234 characters were constant, 45 characters were parsimony-uninformative and 305 characters were parsimony-informative.

The sequence of the ITS region taken from S. lipingense aligned with the genus Sedum, confirming its generic identity (Fig. 1). The new species was resolved as sister to S. bulbiferum (Bayesian posterior probabilities (PP) was 97) but turned out to be genetically distant from S. subtile. There were 50 nucleotides differ between S. lipingense and S. bulbiferum, suggesting the high variation compared to the closest relatives was remarkable.

Figure 1. 

Bayesian phylogenetic tree based on ITS sequence for genus Sedum related to S. lipingense and three outgroups. Bayesian posterior probabilities are shown.

S. lipingense and S. bulbiferum were found to be nested with S. hangzhouense (PP = 41, suggesting a weak support), and then to be nested with S. baileyi and S. makinoi (PP = 100), all species with alternate or opposite stem leaves. Except for S. lipingense, the above four (or perhaps two-three) species were also clustered as a distinct clade (Wu et al. 2013, Xie et al. 2014, Ito et al. 2017a), suggesting that the four species are closely related. Sedum lipingense is a close member to this clade, but these species form a polytomy and it is hard to say for sure, which one is the closest relative of S. lipingense. Sedum subtile is not within the same clade as S. bulbiferum, S. hangzhouense, S. baileyi, and S. makinoi (Wu et al. 2013) or with S. hangzhouense, S. baileyi, and S. makinoi (Ito et al. 2017a), suggesting that the relationship between S. subtile and S. lipingense is relatively distant.

Taxonomy

Sedum lipingense R.B. Zhang, D. Tan & R.X. Wei, sp. nov.

urn:lsid:ipni.org:names:77202732-1
Figs 2, 3, 4

Diagnosis

S. lipingense can be distinguished from the closely related S. subtile and S. bulbiferum by the presence of rosettes, absent sterile shoots and bulbils, subequal lanceolate-oblong sepals, and other traits (Table 2).

Table 2.
Download as
CSV
XLSX

Comparing the diagnostics of Sedum lipingense sp. nov., S. subtile and S. bulbiferum.

Traits S. lipingense S. subtile S. bulbiferum
Rosette leaves during florescence present absent absent
Sterile shoots absent present absent
Flowering stem 3–7 cm 5–10 cm 7–22 cm
Proximal stem leaves Phyllotaxy alternate, sometimes opposite on lateral flowering stem opposite or 3–6-verticillate opposite
Leaf blade broadly obovate obovate ovate-spatulate
Distal stem leaves Phyllotaxy alternate (sometimes subopposite) alternate alternate
Leaf blade spatulate-oblanceolate oblanceolate-linear spatulate-oblanceolate
Bulbils in axils absent absent present
Cymes Branches (2-) 3 2- or 3-branched 3-branched, branches 2-forked
Branch flowers 1- to two 3- to several many
Sepals lanceolate-oblong, subequal broadly linear to narrowly lanceolate, unequal lanceolate to oblanceolate, unequal
Nectar scales broadly cuneate, ca. 0.6 × 0.4 mm, apex truncate broadly cuneate, ca. 0.4 × 0.5 mm, apex truncate obovate, ca. 0.6 mm
Carpels ca. 3.5 mm base connate for ca. 1 mm ca. 5 mm base connate for ca. 2 mm ca. 4 mm base connate for ca. 1 mm
Styles ca. 1 mm ca. 2 mm ca. 1 mm
Fl. Apr–May Apr–Jun Apr–May
Fr. May–Jun Jul–Aug Jun–Jul

Type

CHINA. Guizhou Province, Kaili City, Liping County, Mengyan Township, on moist rocks, 26°07'N, 108°42'E, 800 m alt., 13 April 2019, ZRB1479 (fl., holotype ZY!, isotype IBK!), 16 June 2019, ZRB1495 (fr., paratype ZY!)

Description

Biennial (or perennial?) herb. Sterile stems absent. Rosette present during florescence; rosette leaves alternate, broadly obovate, base attenuated and shortly spurred, 0.5–1.5 × 0.4–0.7 cm. Flowering stems 1 to 3 (–4), erect, slender, 3–7 cm; single stems shoot from rosette centers, others shoot from the rosette leaf axils; lateral proximal leaves sometimes opposite, akin to rosette leaves but smaller, 0.6–0.8 × 0.3–0.5 cm, base shortly spurred; distal leaves alternate, spatulate-obovate to spatulate-oblanceolate, 0.7–1.2 × 0.3–0.4 cm, apex obtuse, base shortly spurred. Cymes scorpioid, 2 to 3 branched; branches 1 to 2 flowered; bracts obliquely oblanceolate, apex obtuse, 4–9 × 2–4 mm. Sepals 5, lanceolate-oblong, subequal, ca. 2 mm, base shortly spurred, apex obtuse. Petals 5, yellow, broadly lanceolate, ca. 4 mm, apex mucronate. Stamens 10; antesepalous one ca. 3 mm; antepetalous one inserted ca. 1 mm above petal base, slightly shorter than the antesepalous stamens. Nectar scales broadly cuneate, ca. 0.6 × 0.4 mm, apex truncate. Carpels erect, lanceolate, ca. 3.5 mm, base connate for ca. 1 mm. Styles slender, ca. 1 mm. Follicles stellately divergent at maturity. Seeds oblong, ca. 0.6 mm, papillate.

Figure 2. 

Sedum lipingense A natural habitat B 3-branched scorpioid cyme C follicles and bracts D single flowering stems derived from rosette centers. Charted by Ren-Bo Zhang.

Figure 3. 

Sedum lipingense A flowering plant B opened corolla C sepals D two follicles E seed F nectar scales G rosette leaf H distal leaf I bract of flower. Drawn by Tan Deng.

Figure 4. 

Sedum lipingense A rosette, central and lateral flowering stems B nectar scales C bracts of flowers D distal leaves E rosette leaves F opened corolla G sepals H split carpels I seed. Charted by Ren-Bo Zhang.

Distribution and habitat

At this time, based on our field observations, Sedum lipingense is only known to occur in Longxi village, Mengyan town, Liping County, Guizhou Province. It grows on moist limestone rocks, at ca. 800 m altitude, in groups of several hundred individuals.

Conservation status

This species is currently known to occur in a single valley and we suggest its placement in the Data Deficient category of IUCN (2017).

Phenology

This new species was observed flowering from April to May and fruiting from May to June.

Etymology

The specific epithet ‘lipingense’ is derived from the plant’s locality, Liping County, Guizhou Province, China.

Acknowledgments

This work was supported by grants from the Doctor Foundation of Zunyi Normal College (BS[2018]17), the Science and Technology Bureau of Zunyi City – Zunyi Normal College Foundation Joint Project ([2018]11), the Innovation Ability Promotion Plan of Guizhou Higher School (QJHXTCXZ [2013]11).

References

  • Chen ML, Han X, Zhang LF, Cao XH (2017) Sedum peltatum (Crasulaceae): A new species from Anhui, China. Bangladesh Journal of Botany 46(3): 847–852.
  • Fu SX, Fu KJ (1984) Crassulaceae. Flora of China (vol 34-1). Science Press, Beijing, 31–220.
  • Fu KJ, Ohba H (2001) Crassulaceae. In: Wu ZY, Raven PH (Eds) Flora of China, vol 8. , Brassicaceae through Saxifragaceae. Science Press, Beijing and Missouri Botanical Garden Press, St Louis, 202–268.
  • Ito T, Nakanishi H, Chichibu Y, Minoda K, Kokubugata G (2017a) Sedum danjoense (Crassulaceae), a new species of succulent plants from the Danjo Islands in Japan. Phytotaxa 309(1): 23–34. https://doi.org/10.11646/phytotaxa.309.1.2
  • Ito T, Yu CC, Nakamura K, Chung KF, Yang QE, Fu CX, Qi ZC, Kokubugata G (2017b) Unique parallel radiations of high-mountainous species of the genus Sedum (Crassulaceae) on the continental island of Taiwan. Molecular Phylogenetics and Evolution 113: 9–22. https://doi.org/10.1016/j.ympev.2017.03.028
  • Jin XF, Zhang HW, Xie JB, Zhao YJ (2010) Taxonomic Notes on Sedum s. str. (Crasullaceae) from Zhejiang Province, China. Journal of Hangzhou Normal University 9(3): 165–171. [Natural Science Edition]
  • Jin SH, Zhou YY, Ding BY, Wang RW, Jin XF (2013) Sedum kuntsunianum (Crassulaceae: Sedoideae), a new species from southern Zhejiang, China. Phytotaxa 105(2): 33–38. https://doi.org/10.11646/phytotaxa.105.2.1
  • Li YK, Huang WL, Wang XG, Zhang XS, Wu JR (1985) Crassulaceae. In: Flora of Guizhou, vol 2. Guizhou People’s Press, Guiyang, 173–197.
  • Wang H, Song XJ, Liu QW (2005) Sedum hoi, a New Species of the Crassulaceae from Zhejiang, China. Yunnan Zhi Wu Yan Jiu 27(3): 381–382.
  • Wu LH, Liu YJ, Zhou SB, Guo FG, Bi D, Guo XH, Baker AJM, Smith JAC, Luo YM (2013) Sedum plumbizincicola X.H. Guo et S.B. Zhou ex L.H. Wu (Crassulaceae): A new species from Zhejiang Province, China. Plant Systematics and Evolution 299(3): 487–498. https://doi.org/10.1007/s00606-012-0738-x
  • Xie DM, Peng DY, Fang CW, Qin MJ, Wang DQ, Huang LQ (2014) Sedum spiralifolium (Crassulaceae): A new species from Anhui Province, China. Phytotaxa 183(3): 171–182. https://doi.org/10.11646/phytotaxa.183.3.4
  • Yang CD, Wang XY, Gou GQ (2012) Sedum fanjingshanensis C. D. Yang et X. Y. Wang, a new species of Sedum L. Bulletin of Botanical Research 32(4): 389–391.
login to comment