Research Article |
Corresponding author: Jun Wen ( wenj@si.edu ) Academic editor: Alexander Sukhorukov
© 2018 Xiaodan Xu, Wei Zheng, Vicki A. Funk, Kexin Li, Jie Zhang, Jun Wen.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Xu X, Zheng W, Funk VA, Li K, Zhang J, Wen J (2018) Home at last III: Transferring Uechtritzia and Asian Gerbera species into Oreoseris (Compositae, Mutisieae). PhytoKeys 96: 1-19. https://doi.org/10.3897/phytokeys.96.23142
|
Recently the Asian Gerbera species were shown to form a clade that was not the sister group of the African Gerbera. In this study, the position of the Asian Gerbera species was further assessed based on morphology and molecular phylogenetic analyses that included six Asian Gerbera and 26 other species from the Gerbera-complex. Morphological results showed that the six Asian Gerbera species, which were sampled, bear leaves with the adaxial epidermal surface lacking stomates, possess bracteate scapes and lack inner ray florets. These characters suggest that the Asian Gerbera species are most closely related to the species of Uechtritzia, which also share similar pollen grain size and shape with the Asian Gerbera, rather than to the African Gerbera. Furthermore, the phylogenetic results based on two nuclear (ITS and ETS) and three chloroplast (trnL–trnF, trnL–rpl32 and trnC–petN) sequences strongly support the Asian Gerbera and Uechtritzia forming a clade, with the latter nested within the Asian Gerbera species. Both morphological and molecular phylogenetic data thus confirmed the taxonomic identity of the Asian Gerbera and Uechtritzia. The authors herein formally treat the nine species of the Asian Gerbera and the three species of Uechtritzia as members of the genus Oreoseris, which is the earliest generic name of this lineage and has the nomenclatural priority.
Compositae , Gerbera-complex, Oreoseris , Uechtritzia , SEM, stomata, pollen, South America, Africa, Asia
The Gerbera-complex (Compositae: Mutisieae) contains eight genera: Gerbera L., Leibnitzia Cass., Uechtritzia Freyn, Amblysperma Benth., Chaptalia Vent., Trichocline Cass., Perdicium L. and Lulia Zardini. Gerbera currently contains about 31 species, which belong to six sections: the five African sections: sect. Gerbera (8 species), sect. Parva H.V.Hansen (1 species), sect. Lasiopus (Cass.) Sch.Bip. (6 species), sect. Pseudoseris (Baill.) C.Jeffrey (8 species, distributed in Madagascar) and sect. Piloselloides Less. (2 species, one of which is widespread in Asia and Africa) and the Asian sect. Isanthus (Less.) Jeffrey (6 species;
The Asian Gerbera section Isanthus is characterised mainly by campanulate involucres, naked receptacles and rostrate achenes (
Species of Uechtritzia have hemispherical involucres, fimbriate receptacles and slightly rostrate achenes (
In this study, the phylogenetic position of the Asian Gerbera was tested by expanding the taxon sampling of the Asian and African Gerbera and the Uechtritzia species and using both molecular (two nuclear markers: ITS and ETS and three chloroplast markers: trnL–trnF, trnL–rpl32 and trnC–petN) and morphological data (leaf adaxial surface, pollen, scape and floral morphology).
A total of 32 species from eight genera of the Gerbera-complex and Adenocaulon chilense (outgroup) were sampled for this study (Tables
Adaxial leaf epidermal and pollen morphology. A small area of the leaf lamina (about 0.5–1.0 cm2) was placed with the adaxial side exposed, on carbon tape over stubs for the scanning electron microscopy (SEM). For the pollen analysis, samples were dehydrated and were then placed on aluminium stubs using double-sided adhesive tape following
DNA extraction, amplification and sequencing. The DNA molecular work was undertaken in the Laboratory of Analytical Biology (LAB) of
Five markers including two nuclear ribosomal ITS and ETS and three chloroplast trnL–trnF, trnL–rpl32 and trnC–petN intergenic spacers were amplified. The ITS primers were designed by
The cycle sequencing programme was 30 cycles of 95 °C for 30 s, 50 °C for 30 s and 60 °C for 4 min. The resultant product was sephadex-filtered and sequenced through an ABI 3730 automated sequencer (Applied Biosystems, Foster City, USA). Sequences were aligned by using MAFFT (
A total of 16 sequences of eight species were retrieved from NCBI for the related taxa within the tribe Mutisieae (Table
Adaxial leaf epidermal morphology. The results of the SEM work (Table
Voucher information and morphological characters of Gerbera and related species.
Species | Section | Locality | Voucher information | Adaxial leaf stomata | Bracts on scape | Inner rays | Pollens | |
---|---|---|---|---|---|---|---|---|
Polar axis (µm) | P/E ratio | |||||||
Gerbera viridifolia (DC.) Sch.Bip. | Lasiopus | Kenya | T.H. Trinder-Smith s.n. (US) | + | − | + | 44.12 | 1.21 |
G. jamesonii Adlam | Lasiopus | Cultivar | T. Derby s.n. (US) | + | − | + | 45.77 | 1.29 |
G. aurantiaca Sch.Bip. | Lasiopus | South Africa | Bayliss 2505 (US) | + | − | + | 43.48 | 1.20 |
G. ambigua Sch.Bip. | Lasiopus | South Africa | M. Koekemoer 2097 (US) | + | − | + | 44.98 | 1.38 |
G. piloselloides Cass. | Piloselloides | Swaziland | M. Koekemoer 2590 (US) | + | − | + | 42.09 | 1.28 |
G. cordata Less. | Piloselloides | Madagascar | T.B. Croat 29083 (MO) | + | − | + | 43.19 | 1.27 |
G. perrieri Humbert | Pseudoseris | Madagascar | L. Gautier 3110 (MO) | + | − | + | 44.04 | 1.29 |
G. diversifolia Humbert | Pseudoseris | Madagascar | B. Lewis 1201 (MO) | + | − | + | 45.31 | 1.20 |
G. crocea Kuntze | Gerbera | South Africa | M. Koekemoer 2029 (US) | + | + | − | 53.83 | 1.39 |
G. linnaei Cass. | Gerbera | South Africa | E. Werdermann 749 (US) | + | + | − | 47.01 | 1.25 |
G. tomentosa DC. | Gerbera | South Africa | P. Bond 745 (US) | + | + | − | 50.43 | 1.26 |
G. wrightii Harv. | Gerbera | South Africa | P. Goldblatt 5287 (US) | + | + | − | N | N |
G. serrata Druce | Gerbera | South Africa | M. Koekemoer 2001 (PRE) | + | + | − | N | N |
G. gossypina Beauverd | Isanthus | India | W.N. Koelz 4828 (US) | − | + | − | 50.05 | 1.40 |
G. maxima Beauverd | Isanthus | India | D.H. Nicolson 2755 (US) | − | + | − | 50.41 | 1.26 |
G. delavayi Franch. | Isanthus | China | X. Xu 1102 (KMUST) | − | + | − | 51.90 | 1.27 |
G. nivea Sch.Bip. | Isanthus | China | J.F. Rock 6430 (US) | − | + | − | 50.30 | 1.39 |
G. raphanifolia Franch. | Isanthus | China | J.F. Rock 10504 (US) | − | + | − | 51.74 | 1.28 |
G. henryi Dunn | Isanthus | China | W.B. Hemsley 1903 (US) | − | + | − | 51.91 | 1.33 |
Uechtritzia armena Freyn | N | Turkey | A. Kaya 1835 (EU) | N | + | − | N | N |
U. lacei (G.Watt) C.Jeffrey | N | India | W. Koelz 8710 (NA) | − | + | − | 50.86 | 1.36 |
U. kokanica (Regel et Schmalh.) Pobed. | N | Tajikistan | F.L. Zaprjagaev 4682 (US) | − | + | − | 55.80 | 1.31 |
Leibnitzia anandria (L.) Nakai | N | China | I. Thomas 8183 (US) | + | + | − | 34.45 | 1.10 |
L. nepalensis (Kunze) Kitam. | N | China | J. Wen 542 (US) | + | + | − | 32.16 | 1.20 |
L. occimadrensis G.L.Nesom | N | Mexico | H.S. Gentry 7189 (US) | + | + | − | 37.33 | 1.16 |
Amblysperma scapigera Benth. | N | Australia | A. Morrison s.n. (US) | + | + | − | 51.60 | 1.17 |
A. spathulata (A.Cunn. ex DC.) D.J.N.Hind | N | Australia | R.A. Davis 8267 (US) | + | + | − | 55.10 | 1.23 |
Voucher information and GenBank accessions of Gerbera and the related species.
Species | Locality | Voucher information | ITS | ETS | trnL–trnF | trnL–rpl32 | trnC–petN |
---|---|---|---|---|---|---|---|
Gerbera viridifolia (DC.) Sch.Bip. | South Africa | T.H. Trinder-Smith s.n. (US) | MG661696* | MG661588* | MG661639* | MG661670* | MG661628* |
G. crocea Kuntze | South Africa | M. Koekemoer 2029 (US) | MG661709* | MG661606* | MG661645* | MG661683* | MG661618* |
G. delavayi Franch. | China | X. Xu 1102 (KMUST) | MG661708* | MG661605* | MG661659* | MG661682* | MG661619* |
G. henryi Dunn | China | X. Xu 1103 (KMUST) | MG661706* | MG661602* | MG661655* | MG661681* | MG661621* |
G. nivea Sch.Bip. | China | Y.S. Chen 2674 (PE) | MG661703* | MG661598* | MG661648* | MG661678* | N |
G. aurantiaca Sch.Bip. | South Africa | Bayliss 2505 (US) | MG661711* | MG661610* | MG661637* | MG661687* | MG661615* |
G. ambigua Sch.Bip. | South Africa | M. Koekemoer 2097 (US) | MG661712* | MG661611* | MG661636* | MG661688* | N |
G. jamesonii Adlam | Cultivar | T. Derby s.n. (US) | MG661704* | MG661599* | MG661638* | MG661679* | MG661624* |
G. cordata Less. | South Africa | J. Wen 10067 (US) | N | MG661608* | MG661661* | MG661685* | MG661617* |
G. piloselloides Cass. | Swaziland | M. Koekemoer 1972 (US) | MG661701* | MG661592* | MG661650* | MG661675* | MG661625* |
G. wrightii Harv. | South Africa | P. Goldblatt 5287 (US) | MG661695* | MG661587* | MG661642* | N | N |
G. serrata Druce | South Africa | M. Koekemoer 2001 (PRE) | MG661697* | MG661590* | MG661656* | MG661671* | N |
G. diversifolia Humbert | Madagascar | B. Lewis 1201 (MO) | N | MG661604* | MG661640* | N | N |
G. raphanifolia Franch. | China | Rock JF 10504 (US) | N | N | MG661658* | N | MG661626* |
G. gossypina Beauverd | India | W.N. Koelz 4824 (US) | MG661707* | MG661603* | MG661646* | N | MG661620* |
G. maxima Beauverd | India | F. Kingdom-Ward 18199 (NY) | KX349402 | N | KX349371 | N | N |
Uechtritzia lacei (G.Watt) C.Jeffrey | India | W. Koelz 8710 (NA) | N | N | MG661644* | N | N |
U. kokanica (Regel & Schmalh.) Pobed. | Tajikistan | F.L. Zaprjagaev 4682 (US) | N | MG661580* | MG661643* | N | MG661635* |
U. kokanica (Regel & Schmalh.) Pobed. | Tajikistan | Zaprjagaev s.n. (NY) | KX349400 | N | KX349401 | N | N |
Amblysperma scapigera Benth. | Australia | A. Morrison s.n. (US) | MG661713* | MG661612* | N | MG661689* | N |
A. spathulata (A.Cunn. ex DC.) D.J.N.Hind | Australia | Cranfield 16197 (CANB) | JX564767 | N | KF989620 | N | N |
Adenocaulon chilense Less. | Chile | G.L. Sobel 2558 (US) | MG661714* | N | N | MG661690* | N |
Chaptalia pringlei Greene | Mexico | G. Nesom 4405 (US) | GU126773 | N | N | N | N |
C. hieracioides (Kunth) X.-D.Xu & W.Zheng | Ecuador | P.M. Peterson 9287 (US) | MG661705* | MG661601* | MG661657* | MG661680* | N |
Trichocline reptans (Wedd.) Hieron | Argentina | E. Pasini & F. Torchelsen 1025 (ICN) | KX349398 | N | KX349399 | KX349410 | N |
Leibnitzia anandria (L.) Nakai | China | I. Thomas 8183 (US) | MG661694* | MG661585* | MG661662* | MG661668* | MG661629* |
L. anandria (L.) Nakai | Japan | Z.Y. Wu 8985 (KUN) | MG661692* | MG661584* | MG661664* | MG661667* | MG661631* |
L. occimadrensis G.L.Nesom | Mexico | H.S. Gentry 7189 (US) | GU126784 | MG661583* | N | MG661666* | MG661632* |
L. nepalensis (Kunze) Kitam. | China | J. Wen 542 (US) | KX349373 | MG661582* | KX349374 | GU126759 | MG661633* |
L. lyrata (Sch.Bip.) G.L.Nesom | USA | G. Nesom 24778 (ARIZ) | GU126779 | N | N | GU126757 | N |
Marker | Primers and sequences 5'–3' | PCR protocol: initial pre-heating; DNA denaturation; primer annealing; DNA extension; final extension |
---|---|---|
ITS | ITS5A: GGAAGGAGAAGTCGTAACAAGGITS4: TCCTCCGCTTATTGATATGC | 95 °C 1 min; 54 °C 1 min; 72 °C 1 min; 72 °C 10 min; 35 cycles |
ETS | 18s-ETS: ACTTACACATGCATGGCTTAATCTETS-Hel-1: GCTCTTTGCTTGCGCAACAACT | 94 °C 0:30 min; 60 °C 0:40 min; 72 °C 1:20 min; 72 °C 5 min; 30 cycles |
trnL–trnF | trnL-Fc: CGAAATCGGTAGACGCTACGtrnL-Ff: ATTTGAACTGGTGACACGAG | 94 °C 1 min; 53 °C 1 min; 72 °C 2 min; 72 °C 10 min; 35 cycles |
trnL–rpl32 | trnL: TACCGATTTCACCATAGCGGrpl32: AGGAAAGGATATTGGGCGG | 95 °C 3 min; 51 °C 40 s; 72 °C 1:20 min; 72 °C 5 min; 35 cycles |
trnC–petN | trnC: CCAGTTCAAATCTGGGTGTCpetN: GGATATAGTAAGTCTTGCTTGGG | 95 °C 3 min; 54 °C 45 s; 72 °C 1:20 min; 72 °C 8 min; 35 cycles |
Pollen morphology. The pollen grains of the examined species of the Gerbera-complex are very similar to one another, differing only in the size of the grains as well as the granules on the surfaces (Figs
Phylogenetic analysis. The Bayesian analysis of the combined nuclear markers and three plastid genes showed six clades of the sampled species of the Gerbera-complex, all showing a strong geographic signal (Fig.
Based on this study, the Asian Gerbera and the Uechtritzia species share several morphological characters, including bracteate scapes, absence of inner ray florets, no stomates on the adaxial leaf surface and similar pollen size and shape (Table
Some previous workers argued that the species of Asian Gerbera (sect. Isanthus) should be treated as an entity, separate from African Gerbera (
The two Uechtritzia species sampled in the molecular phylogeny (Fig.
Leibnitzia is a genus containing about six species with a disjunct distribution: four species in Asia (
Based on the molecular phylogenetic results, the Asian Gerbera species are closest to Uechtritzia, with the latter nested within the Asian Gerbera species. Leibnitzia shows significant morphological differences to the Asian Gerbera + Uechtritzia. The taxonomic identity of Uechtritzia and the Asian Gerbera is strongly supported by the morphology of inflorescences, scapes, capitula, pollen and the lack of stomates on the adaxial leaf surface. Therefore, the authors herein include the nine Asian Gerbera species and the three Uechtritzia species in Oreoseris DC. which is the earliest available name for the expanded Eurasian genus.
In trying to determine the correct genus name for the Eurasian clade, it is necessary to investigate three relevant generic names. Gerbera L. was described in 1758; Arnica gerbera L. is the basionym of the African species G. linnaei Cass., the conserved type of Gerbera L. (lectotype designated by
When Oreoseris nivea DC. was absorbed into Gerbera, the priority was given to Gerbera because the latter was the older generic name and, as long as this species stayed in Gerbera, the name Oreoseris was not available. Uechtritzia was described later in 1892; and, as long as O. nivea remained in Gerbera, then Oreoseris continued to be unavailable.
However, as soon as Gerbera nivea from Asia was removed from Gerbera and a separate genus was formed from the Asian species of Gerbera + Uechtritzia, then the name Oreoseris became available and it is the oldest available name. Hence, these species have been transferred into Oreoseris.
Onoseris sect. Isanthus Less., Linnea 5: 338. 1830. Onoseris subgen. Isanthus (Less.) Less., Syn. Comp.: 119. 1832. Gerbera sect. Isanthus (Less.) C.Jeffrey, Kew Bull. 21: 213. 1967.
Gerbera sect. Oreoseris (DC.) Sch.Bip., Flora 27: 780. 1844.
Uechtritzia Freyn, Oesterr. Bot. Z. 42(7): 240. 1892. Gerbera sect. Uechtritzia (Freyn) Beauverd, Bull. Soc. Bot. Genève Ser. 2, 2: 43. 1910.
Oreoseris nivea DC., designated by
Oreoseris has the following 12 species from Eurasia.
Uechtritzia armena Freyn et Sint., Oesterr. Bot. Z. 42(7): 241. 1892. Gerbera armena Beauverd, Bull. Soc. Bot. Genève, ser. 2, 2: 43. 1910.
Armenia and Turkey.
Gerbera delavayi Franch., J. Bot. (Morot). 2: 68. 1888.
China (Guizhou, Sichuan, Yunnan) and N Vietnam.
Chaptalia gossypina Royle, Ill Bot. Himal. 251. T. 59. F. 2. 1835. Gerbera gossypina (Royle) Beauverd, Bull. Soc. Bot. Genève Ser. 2, 2: 40. 1910.
Oreoseris lanuginosa DC., Prodr. 7(1): 17. 1838. Gerbera lanuginosa (DC.) Sch.Bip., Flora 27: 780. 1844.
Karakoram, N and C Himalaya.
Gerbera henryi Dunn, J. Linn. Soc., Bot. 35: 511. 1903. Gerbera delavayi var. henryi (Dunn) C.Y.Wu et H.Peng, Acta Bot. Yunnan. 24: 143. 2002.
China (Yunnan).
Gerbera kokanica Regel et Schmalh., Descr. Pl. Nov. Rar. Fedtsch. 53. 1882 (published as Izv. Imp. Obsc. Ljubit. Estesv. Moskovsk. Univ. 34(2): 53. 1882). Uechtritzia kokanica (Regel et Schmalh.) Pobed., Fl. URSS 28: 597. 1963.
Pamir-Altai and Tian-Shan regions of C Asia, south to Afghanistan and Kashmir.
Gerbera lacei G.Watt Bull. Misc. Inform. Kew 1911(6): 272. 1911. Uechtritzia lacei (G.Watt) C.Jeffrey, Kew Bull. 21(2): 213. 1967.
N India (Himachal Pradesh), S Jammu and Kashmir (Nachar, Baspa, E and NE of Simla, Chamba and Kisthwar).
Gerbera latiligulata Y.C.Tseng, Acta Bot. Austro-Sin. 3: 11. 1986.
China (in Qiaojia county of Yunnan).
Chaptalia maxima D.Don, Prodr. Fl. Nepal. 166. 1825. Gerbera maxima (D.Don) Beauverd, Bull. Soc. Bot. Genève Ser. 2, 2: 44. 1910.
China (Xizang), Bhutan, India, Nepal, Pakistan and Thailand.
Gerbera nivea (DC.) Sch.Bip., Flora 27: 780. 1844.
China (W Sichuan, S Xizang, NW Yunnan), Bhutan, India and Nepal.
Gerbera raphanifolia Franch., J. Bot. (Morot). 2: 67. 1888.
China (NW Yunnan).
Gerbera rupicola T.G.Gao et D.J.N.Hind, Fl. China 20–21: 14. 2011.
Gerbera macrocephala Y.C.Tseng, Acta Bot. Austro Sin. 3: 12. 1986, not Gerbera macrocephala Less., Linnaea 5: 295. 1830.
China (NW Yunnan).
Gerbera tanantii Franch., J. Bot. (Morot). 7: 155. 1893.
China (Yunnan).
This work was supported by the National Natural Science Foundation of China (no. 31560086), the China Scholarship Council, the Social Science Foundation of Kunming University of Science and Technology (no. kkz3201655009), Laboratory of Analytical Biology and the SEM Lab both of the National Museum of Natural History (