Research Article
Print
Research Article
Home at Last II: Gerbera hieracioides (Kunth) Zardini (Mutisieae, Asteraceae) is really a Chaptalia
expand article infoXiaodan Xu, Wei Zheng, Vicki A. Funk§, Jun Wen§
‡ Kunming University of Science and Technology, Kunming, China
§ Smithsonian Institution, Washington, United States of America
Open Access

Abstract

Gerbera hieracioides (Kunth) Zardini of the Gerbera-complex (Mutisieae, Asteraceae/Compositae) is distributed in Ecuador and Peru. This perennial herb was first named as Onoseris hieracioides Kunth and was later recognised as Trichocline hieracioides (Kunth) Ferreyra. Now it is generally treated as Gerbera hieracioides (Kunth) Zardini but it has never been included in any section of Gerbera. In this study, the position of Gerbera hieracioides is assessed based on morphology and a molecular phylogeny that includes G. hieracioides and 28 other species from the Gerbera-complex. Morphologically, G. hieracioides bears leaves with the adaxial epidermal surface without stomates but with soft thin trichomes, bracteate scapes, trimorphic capitula and inner ray florets with the corolla shorter than the style. These characters suggest that the species is most closely related to Chaptalia rather than to Gerbera or Trichocline. Furthermore, the phylogenetic results based on two nuclear (ITS and ETS) and two chloroplast (trnL–trnF and trnL–rpl32) sequences strongly support the placement of G. hieracioides nested within Chaptalia. As both morphological characters and the molecular phylogenetic results support the transfer of G. hieracioides to Chaptalia, this enigmatic taxon is recognised as Chaptalia hieracioides (Kunth) X.-D. Xu & W. Zheng.

Keywords

Compositae, Gerbera hieracioides, Trichocline hieracioides, Chaptalia hieracioides, Gerbera-complex, SEM, stomata, South America, Africa, Asia

Introduction

Gerbera hieracioides (Kunth) Zardini (Mutisieae, Asteraceae) is a species belonging to the Gerbera-complex (Gerbera L., Leibnitzia Cass., Uechtritzia Freyn, Amblysperma Benth., Chaptalia Vent., Trichocline Cass., Perdicium L. and Lulia Zardini). The species is distributed in Ecuador and Peru. This perennial herb was first named as Onoseris hieracioides Kunth in 1818. It was transferred to Trichocline hieracioides (Kunth) Ferreyra in 1944. In 1974, Zardini moved this species out of Trichocline because it did not have the characters which were used to define that genus. The apex of achenes is truncate in Trichocline but tapering or beaked in G. hieracioides (Zardini 1974, Hansen 1990). Zardini (1974, 1975) moved it into Gerbera because it had bracteate scapes, uniseriate ray florets, achenes rostrate at the apex and slender achene hairs. However, Gerbera and Chaptalia were found to share the same traits such as achenes rostrate at the apex (Katinas 2004) and the transfer of Trichocline hieracioides to Gerbera remained controversial (Hansen 2006).

Gerbera currently contains about 32 species, which belong to six sections: the three African sections: Gerbera (8 species), Parva H.V.Hansen (1 species) and Lasiopus (Cass.) Sch.Bip. (6 species), the Aisan section Isanthus (Less.) C. Jeffrey (7 species), the Madagascar section Pseudoseris (Baill.) C. Jeffry (8 species) and section Piloselloides Less. (2 species, one of which is widespread from Asia, Africa and Australia: Hansen 1985a, 1985b, 1988, Johnson et al. 2014, Funk et al. 2016). However, Zardini (1974) did not include G. hieracioides in any section of Gerbera, she only compared it with two species in sect. Lasiopus (Hansen 1988): G. jamesonii Bolus ex Adlam and G. ambigua Sch. Bip. Although G. hieracioides has the trimorphic capitula similar to those of G. sect. Lasiopus (Hansen 1985a) from Africa, it has bracteate scapes, suggesting that it is perhaps related to Gerbera sect. Isanthus (Hansen 1988) from Asia. Furthermore, the SEM studies showed that the achene hairs of G. hieracioides possess a significantly lower L/W ratio than that in either sect. Isanthus or sect. Lasiopus of Gerbera (Hansen 1990). Therefore, it was still difficult to place G. hieracioides into an existing section (or a new section) of the genus Gerbera.

Gerbera is an Old World genus, whereas Chaptalia, Trichocline and the enigmatic G. hieracioides are New World groups (Nesom 2004b, 1995). Recently, phylogenetic analyses of the Gerbera-complex based on molecular data showed that Chaptalia was placed between Trichocline and Gerbera (Baird et al. 2010, Funk et al. 2014, Pasini et al. 2016). This suggested to the authors that the New World G. hieracioides may be a species of Chaptalia.

In this study, the authors seek to determine the correct generic placement of G. hieracioides by sampling 28 congeneric species using both molecular (two nuclear and two chloroplast markers) and morphological data (leaf adaxial surface, scape and floral morphology).

Materials and methods

A total of 29 species from four genera (Gerbera, Amblysperma, Chaptalia and Trichocline) of the Gerbera complex and Adenocaulon chilense (outgroup) were sampled for this study. Most of the specimens were sampled from the United States National Herbarium (US) of the Smithsonian Institution (Tables 1, 2).

Voucher information and morphological characters of Gerbera hieracioides and the related species.

Species Section Locality Voucher information Adaxial leaf Bracts on scape Inner rays
Stomata Trichome
Gerbera viridifolia (DC.) Sch.Bip. Lasiopus Kenya T.H. Trinder-Smith s.n. (US) + +
G. jamesonii Adlam Lasiopus Cultivar V.A. Funk s.n. (US) + +
G. aurantiaca Sch.Bip. Lasiopus South Africa Bayliss 2505 (US) + +
G. ambigua Sch.Bip. Lasiopus South Africa M. Koekemoer 2097 (US) + +
G. piloselloides Cass. Piloselloides Swaziland M. Koekemoer 2590 (US) + +
G. cordata Less. Piloselloides Madagascar T.B. Croat 29083 (MO) + +
G. perrieri Humbert Pseudoseris Madagascar L. Gautier 3110 (MO) + +
G. crocea Kuntze Gerbera South Africa M. Koekemoer 2029 (US) + +
G. wrightii Harv. Gerbera South Africa P. Goldblatt 5287 (US) + +
G. serrata Druce Gerbera South Africa M. Koekemoer 2001 (PRE) + +
G. gossypina Beauverd Isanthus India W.N. Koelz 4828 (US) +
G. maxima Beauverd Isanthus India D.H. Nicolson 2755 (US) +
G. dealvayi Franch. Isanthus China X. Xu 1102 (KMUST) +
G. nivea Sch.Bip. Isanthus China J.F. Rock 6430 (US) +
G. henryi Dunn Isanthus China W.B. Hemsley 1903 (US) +
G. hieracioides (Kunth) Zardini ? Ecuador P.M. Peterson 9287 (US) + +
G. hieracioides (Kunth) Zardini ? Peru R. Ferreyra 15362 (US) + +
Chaptalia pringlei Greene N Mexico Rzedowski 34853 (US) + +
C. mandonii Burkart N Argentina P.M. Simón 438 (US) + +
C. meridensis S.F. Blake N Venezuela L. Aristeguieta 2591 (US) + +
Trichocline cineraria Hook. & Arn. N Argentina A.R. Cuezzo 20mz398 (US) + + -
T. catharinensis Cabrera N Brazil L.B. Smith 11376 (US) + + -

Voucher information and GenBank accessions of Gerbera hieracioides and the related species.

Species Locality Voucher information ITS ETS trnL–trnF trnL–rpl32
Gerbera viridifolia (DC.) Sch. Bip. South Africa T.H. Trinder-Smith s.n. (US) MG661696* MG661588* MG661639* MG661670*
G. crocea Kuntze South Africa M. Koekemoer 2029 (US) MG661709* MG661606* MG661645* MG661683*
G. delavayi Franch. China X. Xu 1102 (KMUST) MG661708* MG661605* MG661659* MG661682*
G. henryi Dunn China X. Xu 1103 (KMUST) MG661706* MG661602* MG661655* MG661681*
G. nivea Sch. Bip. China Y.S. Chen 2674 (PE) MG661703* MG661598* MG661648* MG661678*
G. aurantiaca Sch.Bip. South Africa Bayliss 2505 (US) MG661711* MG661610* MG661637* MG661687*
G. ambigua Sch. Bip. South Africa M. Koekemoer 2097 (US) MG661712* MG661611* MG661636* MG661688*
G. jamesonii Adlam Cultivar T. Derby s.n. (US) MG661704* MG661599* MG661638* MG661679*
G. cordata Less. South Africa J. Wen 10067 (US) N MG661608* MG661661* MG661685*
G. piloselloides Cass. Swaziland M. Koekemoer 2590 (US) MG661701* MG661592* MG661650* MG661675*
G. wrightii Harv. South Africa P. Goldblatt 5287 (US) MG661695* MG661587* MG661642* N
G. serrata Druce South Africa M. Koekemoer 2001 (PRE) MG661697* MG661590* MG661656* MG661671*
G. hieracioides (Kunth) Zardini Ecuador P.M. Peterson 9287 (US) MG661705* MG661601* MG661657* MG661680*
G. hieracioides (Kunth) Zardini Peru J. Campos 5255 (US) N MG661600* N N
Amblysperma scapigera Benth. Australia A. Morrison s.n. (US) MG661713* MG661612* N MG661689*
Adenocaulon chilense Less. Chile G.L. Sobel 2558 (US) MG661714* N N MG661690*
Gerbera maxima Beauverd India F. Kingdom 18199 (NY) KX349402 N KX349371 N
G. gossypina Beauverd India W. Koelz 4294 (US) GU126777 N N GU126755
Adenocaulon chilense Less. Argentina J.M. Bonifacino 3997 (LP) KX349359 N KX349360 N
Chaptalia nutans (L.) Polák Argentina P.M. Simon 477 (US) GU126772 N N GU126751
C. pringlei Greene Mexico G. Nesom 4405 (US) GU126773 N N N
C. runcinata Kuntze Argentina P.M. Simon 415 (US) GU126774 N N GU126752
C. chapadensis D.J.N. Hind Argentina Roque & al. 2188 (ALCB) KF989508 N KF989614 N
C. similis R.E. Fr. Argentina P.M. Simon 711 (US) GU126775 N N GU126753
C. tomentosa Vent. USA V.A. Funk 12303 (US) GU126776 N N GU126754
C. piloselloides (Vahl) Baker Brazil E. Pasini 1021 (ICN) KX349357 N KX349358 KX349403
Trichocline auriculata Hieron Argentina H. Simón & J.M. Bonifacino 633 (US) KX349386 N KX349387 N
T. catharinensis Cabrera Brazil E. Pasini 915 (ICN) KX349388 N KX349389 KX349411
T. caulescens Phil. Chile V.A. Funk & al. 13055 (US) KX349390 N KX349391 KX349406
T. cineraria Hook. & Arn. Argentina E. Pasini & F. Torchelsen 1027 (ICN) KX349392 N KX349393 KX349407
T. plicata Hook. & Arn. Argentina E. Pasini & F. Torchelsen 1023 (ICN) KX349396 N KX349397 KX349409
T. reptans (Wedd.) Hieron Argentina E. Pasini & F. Torchelsen 1025 (ICN) KX349398 N KX349399 KX349410

Adaxial leaf epidermal morphology. Lamina (0.5–1.0 cm2) were placed with the adaxial side exposed on carbon tape over stubs for the scanning electron microscopy (SEM), without soaking the material in different solutions prior to SEM. The stubs bearing leaves were treated with gold-palladium to 16.6 μm thickness and were examined under a Philips XL-30 scanning electron microscope at the SEM Lab of the National Museum of Natural History (NMNH). The 22 samples were subsequently observed and photographed under SEM. Images of the leaves were captured using the proprietary software associated with the Philips SEM. Images of at least 15 different areas of the adaxial leaf surface were captured.

Floret morphology. The florets and scapes of 20 herbarium specimens were examined in the United States National Herbarium, Smithsonian Institution, using an optical microscope.

DNA extraction, amplification and sequencing. The molecular work was performed in the Laboratory of Analytical Biology (LAB) of NMNH (Smithsonian Institution). DNAs of 16 samples (15 species, including two samples of Gerbera hieracioides) were extracted using the AutoGen. Herbarium leaf samples, along with 1.0 and 2.3 mm diameter beads, were dipped in liquid nitrogen then immediately shaken for 30 seconds at 18000 rpm. About 500 ml of CTAB was added to the tubes, vortexed and incubated overnight (500 rpm at 45 °C). Then 300 µl of the supernatant was transferred to an AutoGen plate. AutoGen was run according to the manufacturer’s default settings (AutoGen, Inc., Holliston, MA, USA).

Four markers including two nuclear ribosomal (ITS and ETS) and two chloroplast intergenic spacers (trnL–trnF and trnL–rpl32) were amplified. The ITS primers were designed by Downie and Katz-Downie (1996) and White et al. (1990), ETS primers by Baldwin and Markos (1998), trnL–trnF primers by Taberlet et al. (1991) and trnL–rpl32 spacer primers by Timme et al. (2007) (Table 3). The PCR reaction mixture had a total volume of 25 µl, comprising 14.05 µl nuclease free water, 2.5 µl 10× buffer, 2 µl dNTPs, 1.25 µl MgCl2, 1 µl of both forward and reverse primers, 0.5 µl BSA, 0.2 µl Taq DNA polymerase and 2.5 µl of template DNA. The amplified products were purified with ExoSapIT enzyme with activation at 37 °C and deactivation at 95 °C. 4 µl of the purified product and same primers (1 µl, 1 µM) were cycle-sequenced in a mixture containing 0.8 µl Big Dye (Applied Biosystems, Foster City, USA) and 2.0 µl 5× Big Dye buffer and 4.2 µl water.

Primers and amplification protocols for all markers.

Marker Primers and sequences 5′–3′ PCR protocol: initial pre-heating; DNA denaturation; primer annealing; DNA extension; final extension
ITS ITS5A: GGAAGGAGAAGTCGTAACAAGGITS4: TCCTCCGCTTATTGATATGC 95 °C 1 min; 54 °C 1 min; 72 °C 1 min; 72 °C 10 min; 40 cycles
ETS 18s-ETS: ACTTACACATGCATGGCTTAATCTETS-Hel-1: GCTCTTTGCTTGCGCAACAACT 94 °C 0:30 min; 60 °C 0:40 min; 72 °C 1:20 min; 72 °C 5 min; 30 cycles
trnL–trnF trnL-Fc: CGAAATCGGTAGACGCTACGtrnL-Ff: ATTTGAACTGGTGACACGAG 94 °C 1 min; 53 °C 1 min; 72 °C 2 min; 72 °C 10 min; 35 cycles
trnL–rpl32 trnL: TACCGATTTCACCATAGCGGrpl32: AGGAAAGGATATTGGGCGG 95 °C 3 min; 51 °C 40 s; 72 °C 1:20 min; 72 °C 5 min; 40 cycles

The cycle sequencing programme was 30 cycles of 95 °C for 30 s, 50 °C for 30 s and 60 °C for 4 min. The resultant product was sephadex filtered and sequenced through an ABI 3730 automated sequencer (Applied Biosystems, Foster City, USA). The PCR reactions were performed in a Veriti PCR Thermal Cycler. The amplification protocols for all markers are summarised in Table 3. Sequences were aligned by using MAFFT (Katoh and Standley 2013) using Geneious 10.0.9. (Biomatters Ltd., Auckland, New Zealand) and checked manually. A total of 57 newly generated sequences from the 16 samples were deposited in GenBank (Table 2).

A total of 37 sequences of 16 species were retrieved from NCBI for the related taxa within the tribe Mutisieae (Table 2). Phylogenetic relationships were inferred based on the concatenated ITS+ETS+trnL–rpl32+trnL–trnF data with MrBayes v. 3.2.2 (Ronquist et al. 2012) by using the substitution model of GTR based on the best-fitting model determined using jModelTest 2.1.6 (Posada 2008), the chain length of 10,000,000, rate variation of gamma, gamma categories of 4, heated chains of 4, heated chain temp. of 0.2, subsampling freq. of 200 and burn-in length of 100,000. Tracer v. 1.5 (Rambaut and Drummond 2009) was used to confirm that the effective sample size (ESS) for all relevant parameters was > 200. After discarding the trees as burn-in, a 50 % majority-rule consensus tree and posterior probabilities (PP) for node support were calculated using the remaining trees.

Results

Adaxial leaf epidermal morphology. The results of the SEM work (Table 1) showed that the two tested samples of Gerbera hieracioides have no stomates but have soft, thin and appressed trichomes on the adaxial leaf surface (Figure 1G). These adaxial leaf morphological traits differ from the Gerbera species: (1) they are different from Gerbera sections sampled [sect. Lasiopus (4 species), sect. Piloselloides (2 species) and sect. Pseudoseris (1 species)] which have stomates and stiff, straight, upright trichomes. Figure 1 has images of one sample for each section: G. ambigua (Fig. 1A), G. piloselloides (Fig. 1B) and G. perrieri (Fig. 1D), respectively. (2) they are different from the members of Gerbera sect. Gerbera which have stomates and soft, thin and appressed trichomes. Three species from South Africa were examined and represented by G. crocea (Fig. 1C). (3) they are different from the Asian Gerbera sect. Isanthus which have no stomates and no trichomes based on this study of five species of sect. Isanthus that were examined in the study and are represented by G. maxima (Fig. 1E): the authors’ observations agree with Lin et al. (2008) for the Asian species G. delavayi. Additionally, the morphological traits of G. hieracioides differ significantly from those of the Trichocline species, which have many stomates with guard cells sunken on the leaf surface, illustrated by T. catharinensis (Fig. 1H). However, the two tested G. hieracioides samples share the same adaxial leaf epidermal characters such as soft, thin and appressed trichomes, epidermal cell shape and striations and absence of stomates, with the three examined Chaptalia species, as represented by C. pringlei (Fig. 1F). Therefore, based on the adaxial leaf epidermal morphology, G. hieracioides is most closely related to Chaptalia rather than to Gerbera or Trichocline.

Figure 1. 

Adaxial leaf epidermal surface morphology of Gerbera hieracioides and the related species. A G. ambigua (sect. Lasiopus) B G. piloselloides (sect. Piloselloides) C G. crocea (sect. Gerbera) D G. perrieri (sect. Pseudoseris) E G. maxima (sect. Isanthus) F Chaptalia pringlei G G. hieracioides H Trichocline catharinensis. Arrows point to the soft thin trichomes. Scale bar=50 μm.

Scape and floret morphology. The results (Table 1) showed that the two examined samples of Gerbera hieracioides have bracteate scapes and trimorphic capitula which have the inner rays with corollae shorter than the styles (Fig. 2G, H). The above morphological traits also differ from those of the Gerbera species: (1) Gerbera sect. Lasiopus, sect. Piloselloides and sect. Pseudoseris have ebracteate scapes and trimorphic capitula and the inner rays have corollae as long as the styles or longer. Gerbera jamesonii (Fig. 2A) and G. ambigua (Fig. 2B) belong to sect. Lasiopus and G. cordata (Fig. 2C) for sect. Piloselloides. (2) they are different from Gerbera sect. Gerbera and sect. Isanthus, which have bracteate scapes but dimorphic capitula without inner rays of florets. Three South African species and five Asian species were examined and are illustrated by G. crocea (Fig. 2D), G. nivea (Fig. 2E) and G. gossypina (Fig. 2F). The two tested G. hieracioides samples share the traits of bracteate scapes and trimorphic capitula which have inner rays with corollae shorter than the styles with the three tested Chaptalia species, represented by C. meridensis (Fig. 2I) and C. mandonii (Fig. 2J). Therefore, based on the scape and floret morphology, G. hieracioides should be best considered as a species of Chaptalia rather than Gerbera.

Figure 2. 

Scape and floret morphology of Gerbera hieracioides and the related species. A G. jamesonii (sect. Lasiopus) B G. ambigua (sect. Lasiopus) C G. cordata (sect. Piloselloides) D G. crocea (sect. Gerbera) E G. nivea (sect. Isanthus) F G. gossypina (sect. Isanthus) G G. hieracioides (Ecuador) H G. hieracioides (Peru) I Chaptalia meridensis J C. mandonii. The arrows mark the styles of inner ray florets.

Phylogenetic analysis. The MrBayes analysis of the combined nuclear markers and two plastid genes showed four clades of the sampled species of the Gerbera-complex, all with a strong biogeographic signal (Fig. 3): (1) the African and Australian species of the Gerbera complex (African Gerbera species are sister to the Australian Amblysperma), (2) the American genus Chaptalia and the South American Gerbera hieracioides, (3) the Asian Gerbera species and (4) the South American genus Trichocline. However, there is no well-supported resolution amongst the first three clades mentioned above, so no conclusions can be made about the monophyly of Gerbera at this time.

Figure 3. 

Phylogeny of Gerbera hieracioides and the related species. The phylogeny is based on the MrBayes analysis of the combined ITS and ETS, trnL–trnF and trnL–rpl32 markers. The posterior probabilities support values are shown next to branches.

Both samples of Gerbera hieracioides were nested within the Chaptalia clade. Gerbera hieracioides is sister to Chaptalia pringlei; then the G. hieracioides-C. pringlei clade is sister to the other Chaptalia species with strong support (posterior probability of 1.00). Therefore, the molecular data also support the placement of G. hieracioides in Chaptalia.

Discussion

The molecular phylogeny of the Gerbera-complex showed that G. hieracioides did not group with Trichocline (Fig. 3) but was nested inside Chaptalia. Furthermore, the leaf adaxial epidermis of G. hieracioides has no stomates, while that of Trichocline usually has many stomates (Fig. 1). In addition, Katinas (2004) presented a key to distinguish the genera of the Gerbera-complex and Gerbera and Chaptalia were found to share the same trait of achenes rostrate at the apex but this is not found in Trichocline.

The confusion about the placement of Gerbera hieracioides is no doubt the result of the morphology falling between that of Gerbera and Chaptalia. A good case concerning this point is the inner ray florets of the trimorphic capitula: Gerbera has a corolla as long as the style or longer and the staminodes are present, whereas Chaptalia has the corolla shorter than the style and without staminodes (Katinas 2004). As for G. hieracioides, the inner ray florets have moderately reduced stamens (Fig. 2G, H) which are different from both Gerbera and Chaptalia species. Although the stamen morphology of G. hieracioides is not identical to Chaptalia, their moderately reduced corollae (Fig. 2G, H) are similar to those of Chaptalia rather than those of Gerbera, according to Katinas (2004). Furthermore, the characters of leaf adaxial epidermis of G. hieracioides including the lack of stomates and the presence of soft thin trichomes, as well as bracteate scapes and cell shape and striations, all suggest that the species is closest to Chaptalia. Additionally, Hansen (1990) stated that the achene hairs of G. hieracioides are sub-inflated with a lower L/W-ratio than that of Gerbera. Therefore, the morphological data support the transfer of G. hieracioides to Chaptalia that was consistent with the molecular phylogeny (Fig. 3) based on both nuclear ITS and ETS and chloroplast trnL–trnF and trnL–rpl32. This transfer is in agreement with the geographic distribution (Fig. 3), because G. hieracioides is from South America and all the other Chaptalia species are from the New World (Nesom 2004b, 1995).

Chaptalia is a New World genus and contains about 70 species in the Americas (Funk et al. 2016). Although there are partial regional treatments, there is no comprehensive monograph of the genus (e.g. Burkart 1944, Cabrera and Nesom 2003, Nesom 2004a, b). Hansen (2006) argued that the most significant problem of the Gerbera-complex is the lack of a revisionary treatment of Chaptalia and argued for further studies to test whether Chaptalia is monophyletic. In the molecular analysis (Fig. 3), the nine Chaptalia samples (including G. hieracioides) grouped into two well-supported clades. This result indicates that Chaptalia seems to be monophyletic when G. hieracioides is included. Chaptalia is typically characterised by differentiated and reduced rays (Hansen 1990): the inner ray florets with corolla strongly reduced, filiform (irregularly tubular, ligulate or bilabiate), shorter than the style and without staminodes (Katinas 2004). The inner ray florets of G. hieracioides with moderately reduced corollae and stamens suggest that the inner ray florets of trimorphic capitula may be a key morphological character for the further revisionary treatment of Chaptalia.

As for Gerbera, this study showed that it falls into two distinct clades, one from Africa which is the sister group of the Australian genus Amblysperma and the other contains all the Asian Gerbera (Fig. 3). However, the two Gerbera clades are in a trichotomy with the Chaptalia clade. It is clear that, based on the sampling, the Asian taxa may be best separated out into a separate genus then Amblysperma is the sister genus of African Gerbera. If the two clades of Gerbera form a single clade, then Amblysperma will most likely be nested within that clade. The decision must wait for ongoing studies using additional data. However, it is clear that Gerbera hieracioides should be considered within Chaptalia.

Taxonomic treatment

Chaptalia hieracioides (Kunth) X.-D.Xu & W.Zheng, comb. nov.

Basionym: Onoseris hieracioides Kunth, Nov. Gen. Sp. [H. B. K.] 4 (ed. folio): 5, Tab. 304. 1818; 4 (ed. quarto): 7, Tab. 304. 1820. Type: Ecuador: “Alousi”, A.J.A. Bonpland 3233 (Lectotype: P00322236, here designated).

Trichocline peruviana Hieron., Bot. Jahrb. Syst. 21: 368. 1895. [according to IPNI]

Trichocline hieracioides (Kunth) Ferreyra, J. Arnold Arbor. 25: 394. 1944, comb. illeg. non Baker (1884).

Gerbera hieracioides (Kunth) Zardini, Bol. Soc. Argent. Bot. 16(1–2): 105. 1974.

Trichocline beckerae (as ‘beckeri’) H.Rob., Phytologia 65(1): 47. 1988.

Conclusions

The placement of Gerbera hieracioides within Chaptalia is strongly supported by both the molecular sequence data (two nuclear markers ITS and ETS and two chloroplast markers trnL–trnF and trnL–rpl32) and the morphology of the scape, capitula and the leaf adaxial epidermal surface. Therefore, Gerbera hieracioides has been transferred to Chaptalia and it is recognised as Chaptalia hieracioides (Kunth) X.-D. Xu et W. Zheng.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (no. 31560086), the China Scholarship Council, the Social Science Foundation of Kunming University of Science and Technology (no. kkz3201655009) and the Laboratory of Analytical Biology of the Smithsonian Institution. We are grateful to Marinda Koekemoer (South African National Biodiversity Institute) and Yousheng Chen (Institute of Botany, the Chinese Academy of Sciences, China) for providing samples and AJ Harris, Stanley Yankowski, Scott Whittaker, Carol Kelloff, Harold Robinson and Gabriel Johnson (all of the Smithsonian Institution) and Yuan Xu (South China Botanical Garden, China), Sayed Afzal Shah (Quaid-i-Azam University, Pakistan) and Zhumei Ren (Shanxi University, China) for their assistance with experiments, data analyses and helpful discussions. We also appreciate the suggestions and advice from two reviewers and the subject editor Alexander Sukhorukov.

References

  • Baird KE, Funk VA, Wen J, Weeks A (2010) Molecular phylogenetic analysis of Leibnitzia Cass. (Asteraceae: Mutisieae: Gerbera-Complex): An Asian-North American disjunct genus. Journal of Systematics and evolution 48: 161–174. https://doi.org/10.1111/j.1759-6831.2010.00077.x
  • Baldwin BG, Markos S (1998) Phylogenetic utility of the external transcribed spacer (ETS) of 18S–26S rDNA: Congruence of ETS and ITS trees of Calycadenia (Compositae). Molecular Phylogenetics and Evolution 10: 449–463. https://doi.org/10.1006/mpev.1998.0545
  • Burkart A (1944) Estudio del género de Compuestas Chaptalia con especial referencia a las especies argentinas. Darwiniana 6: 505–594.
  • Downie SR, Katz-Downie DS (1996) A molecular phylogeny of Apiaceae subfamily Apioideae: Evidence from nuclear ribosomal DNA internal transcribed spacer sequences. American Journal of Botany 83: 234–251. https://doi.org/10.1002/j.1537-2197.1996.tb12701.x
  • Ferreyra R (1944) Revisión del género Onoseris. Journal of the Arnold Arboretum 25: 349–395.
  • Funk VA, Pasini E, Bonifacino JM, Katinas L (2016) Home at last: The enigmatic genera Eriachaenium and Adenocaulon (Compositae, Mutisioideae, Mutisieae, Adenocaulinae). PhytoKeys 60: 1–19. https://doi.org/10.3897/phytokeys.60.6795
  • Funk VA, Sancho G, Roque N, Kelloff CL, Ventosa-Rodríguez I, Diazgranados M, Bonifacino JM, Chan R (2014) A phylogeny of the Gochnatieae: Understanding a critically placed tribe in the Compositae. Taxon 63: 859–882. https://doi.org/10.12705/634.27
  • Hansen HV (1985a) A taxonomic revision of the genus Gerbera (CompositaeMutisieae) sections Gerbera, Parva, Piloselloides (in Africa) and Lasiopus. Opera Botanica 78: 5–36.
  • Hansen HV (2006) Comments on the Gerbera-complex (Asteraceae: Mutisieae). SIDA, Contributions to Botany 22: 539–543. jstor.org/stable/41968606
  • Katinas L (2004) The Gerbera-complex (Asteraceae, Mutisieae): To split or not to split. SIDA, Contributions to Botany: 935–940. jstor.org/stable/41968349
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. https://doi.org/10.1093/molbev/mst010
  • Kunth KS (1818) Onoseris hieracioides Kunth. In: Humboldt A, Bonpland A, Kunth KS (Eds) Nova Genera et Species Plantarum, vol. 4 (ed. folio), Maze, Paris, [i–vii], [1]–247, pl. 301–412.
  • Nesom GL (1995) Revision of Chaptalia (Asteraceae: Mutisieae) from North America and continental Central America. Phytologia 78: 153–188.
  • Nesom GL (2004a) Generic placement of Chaptalia hintonii (Asteraceae: Mutisieae). Sida 21: 929–933. jstor.org/stable/41968348
  • Nesom GL (2004b) Response to “The Gerbera complex (Asteraceae: Mutisieae): to split or not to split” by Liliana Katinas. Sida 21: 941–942.
  • Pasini E, Funk VA, de Souza-Chies TT, Miotto STS (2016) New insights into the phylogeny and biogeography of the Gerbera-Complex (Asteraceae: Mutisieae). Taxon 65: 547–562. https://doi.org/10.12705/653.7
  • Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029
  • Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–1109. https://doi.org/10.1007/BF00037152
  • Timme R, Kuehl EJ, Boore JL, Jansen RK (2007) A comparative analysis of the Lactuca and Helianthus (Asteraceae) plastid genomes: Identification of divergent regions and categorization of shared repeats. American Journal of Botany 94: 302–313. https://doi.org/10.3732/ajb.94.3.302
  • White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M, Gelfand D, Sninsky J, White T (Eds) PCR protocols: A guide to methods and applications. Academic Press, San Diego, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • Zardini EM (1974) About the presence of the genus Gerbera in America. Boletin de la Sociedad Argentina de Botánica 16: 103–108.
  • Zardini EM (1975) Revisión del género Trichocline (Compositae). Darwiniana 19: 618–733.