Research Article |
Corresponding author: Jun Wen ( wenj@si.edu ) Academic editor: Alexander Sukhorukov
© 2018 Xiaodan Xu, Wei Zheng, Vicki A. Funk, Jun Wen.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Xu X, Zheng W, Funk WA, Wen J (2018) Home at Last II: Gerbera hieracioides (Kunth) Zardini (Mutisieae, Asteraceae) is really a Chaptalia. PhytoKeys 95: 93-106. https://doi.org/10.3897/phytokeys.95.22916
|
Gerbera hieracioides (Kunth) Zardini of the Gerbera-complex (Mutisieae, Asteraceae/Compositae) is distributed in Ecuador and Peru. This perennial herb was first named as Onoseris hieracioides Kunth and was later recognised as Trichocline hieracioides (Kunth) Ferreyra. Now it is generally treated as Gerbera hieracioides (Kunth) Zardini but it has never been included in any section of Gerbera. In this study, the position of Gerbera hieracioides is assessed based on morphology and a molecular phylogeny that includes G. hieracioides and 28 other species from the Gerbera-complex. Morphologically, G. hieracioides bears leaves with the adaxial epidermal surface without stomates but with soft thin trichomes, bracteate scapes, trimorphic capitula and inner ray florets with the corolla shorter than the style. These characters suggest that the species is most closely related to Chaptalia rather than to Gerbera or Trichocline. Furthermore, the phylogenetic results based on two nuclear (ITS and ETS) and two chloroplast (trnL–trnF and trnL–rpl32) sequences strongly support the placement of G. hieracioides nested within Chaptalia. As both morphological characters and the molecular phylogenetic results support the transfer of G. hieracioides to Chaptalia, this enigmatic taxon is recognised as Chaptalia hieracioides (Kunth) X.-D. Xu & W. Zheng.
Compositae , Gerbera hieracioides , Trichocline hieracioides , Chaptalia hieracioides , Gerbera-complex, SEM, stomata, South America, Africa, Asia
Gerbera hieracioides (Kunth) Zardini (Mutisieae, Asteraceae) is a species belonging to the Gerbera-complex (Gerbera L., Leibnitzia Cass., Uechtritzia Freyn, Amblysperma Benth., Chaptalia Vent., Trichocline Cass., Perdicium L. and Lulia Zardini). The species is distributed in Ecuador and Peru. This perennial herb was first named as Onoseris hieracioides Kunth in 1818. It was transferred to Trichocline hieracioides (Kunth) Ferreyra in 1944. In 1974, Zardini moved this species out of Trichocline because it did not have the characters which were used to define that genus. The apex of achenes is truncate in Trichocline but tapering or beaked in G. hieracioides (
Gerbera currently contains about 32 species, which belong to six sections: the three African sections: Gerbera (8 species), Parva H.V.Hansen (1 species) and Lasiopus (Cass.) Sch.Bip. (6 species), the Aisan section Isanthus (Less.) C. Jeffrey (7 species), the Madagascar section Pseudoseris (Baill.) C. Jeffry (8 species) and section Piloselloides Less. (2 species, one of which is widespread from Asia, Africa and Australia:
Gerbera is an Old World genus, whereas Chaptalia, Trichocline and the enigmatic G. hieracioides are New World groups (
In this study, the authors seek to determine the correct generic placement of G. hieracioides by sampling 28 congeneric species using both molecular (two nuclear and two chloroplast markers) and morphological data (leaf adaxial surface, scape and floral morphology).
A total of 29 species from four genera (Gerbera, Amblysperma, Chaptalia and Trichocline) of the Gerbera complex and Adenocaulon chilense (outgroup) were sampled for this study. Most of the specimens were sampled from the United States National Herbarium (US) of the Smithsonian Institution (Tables
Voucher information and morphological characters of Gerbera hieracioides and the related species.
Species | Section | Locality | Voucher information | Adaxial leaf | Bracts on scape | Inner rays | |
---|---|---|---|---|---|---|---|
Stomata | Trichome | ||||||
Gerbera viridifolia (DC.) Sch.Bip. | Lasiopus | Kenya | T.H. Trinder-Smith s.n. (US) | + | ★ | − | + |
G. jamesonii Adlam | Lasiopus | Cultivar | V.A. Funk s.n. (US) | + | ★ | − | + |
G. aurantiaca Sch.Bip. | Lasiopus | South Africa | Bayliss 2505 (US) | + | ★ | − | + |
G. ambigua Sch.Bip. | Lasiopus | South Africa | M. Koekemoer 2097 (US) | + | ★ | − | + |
G. piloselloides Cass. | Piloselloides | Swaziland | M. Koekemoer 2590 (US) | + | ★ | − | + |
G. cordata Less. | Piloselloides | Madagascar | T.B. Croat 29083 (MO) | + | ★ | − | + |
G. perrieri Humbert | Pseudoseris | Madagascar | L. Gautier 3110 (MO) | + | ★ | − | + |
G. crocea Kuntze | Gerbera | South Africa | M. Koekemoer 2029 (US) | + | ≈ | + | − |
G. wrightii Harv. | Gerbera | South Africa | P. Goldblatt 5287 (US) | + | ≈ | + | − |
G. serrata Druce | Gerbera | South Africa | M. Koekemoer 2001 (PRE) | + | ≈ | + | − |
G. gossypina Beauverd | Isanthus | India | W.N. Koelz 4828 (US) | − | − | + | − |
G. maxima Beauverd | Isanthus | India | D.H. Nicolson 2755 (US) | − | − | + | − |
G. dealvayi Franch. | Isanthus | China | X. Xu 1102 (KMUST) | − | − | + | − |
G. nivea Sch.Bip. | Isanthus | China | J.F. Rock 6430 (US) | − | − | + | − |
G. henryi Dunn | Isanthus | China | W.B. Hemsley 1903 (US) | − | − | + | − |
G. hieracioides (Kunth) Zardini | ? | Ecuador | P.M. Peterson 9287 (US) | − | ≈ | + | + |
G. hieracioides (Kunth) Zardini | ? | Peru | R. Ferreyra 15362 (US) | − | ≈ | + | + |
Chaptalia pringlei Greene | N | Mexico | Rzedowski 34853 (US) | − | ≈ | + | + |
C. mandonii Burkart | N | Argentina | P.M. Simón 438 (US) | − | ≈ | + | + |
C. meridensis S.F. Blake | N | Venezuela | L. Aristeguieta 2591 (US) | − | ≈ | + | + |
Trichocline cineraria Hook. & Arn. | N | Argentina | A.R. Cuezzo 20mz398 (US) | + | ≈ | + | - |
T. catharinensis Cabrera | N | Brazil | L.B. Smith 11376 (US) | + | ≈ | + | - |
Voucher information and GenBank accessions of Gerbera hieracioides and the related species.
Species | Locality | Voucher information | ITS | ETS | trnL–trnF | trnL–rpl32 |
---|---|---|---|---|---|---|
Gerbera viridifolia (DC.) Sch. Bip. | South Africa | T.H. Trinder-Smith s.n. (US) | MG661696* | MG661588* | MG661639* | MG661670* |
G. crocea Kuntze | South Africa | M. Koekemoer 2029 (US) | MG661709* | MG661606* | MG661645* | MG661683* |
G. delavayi Franch. | China | X. Xu 1102 (KMUST) | MG661708* | MG661605* | MG661659* | MG661682* |
G. henryi Dunn | China | X. Xu 1103 (KMUST) | MG661706* | MG661602* | MG661655* | MG661681* |
G. nivea Sch. Bip. | China | Y.S. Chen 2674 (PE) | MG661703* | MG661598* | MG661648* | MG661678* |
G. aurantiaca Sch.Bip. | South Africa | Bayliss 2505 (US) | MG661711* | MG661610* | MG661637* | MG661687* |
G. ambigua Sch. Bip. | South Africa | M. Koekemoer 2097 (US) | MG661712* | MG661611* | MG661636* | MG661688* |
G. jamesonii Adlam | Cultivar | T. Derby s.n. (US) | MG661704* | MG661599* | MG661638* | MG661679* |
G. cordata Less. | South Africa | J. Wen 10067 (US) | N | MG661608* | MG661661* | MG661685* |
G. piloselloides Cass. | Swaziland | M. Koekemoer 2590 (US) | MG661701* | MG661592* | MG661650* | MG661675* |
G. wrightii Harv. | South Africa | P. Goldblatt 5287 (US) | MG661695* | MG661587* | MG661642* | N |
G. serrata Druce | South Africa | M. Koekemoer 2001 (PRE) | MG661697* | MG661590* | MG661656* | MG661671* |
G. hieracioides (Kunth) Zardini | Ecuador | P.M. Peterson 9287 (US) | MG661705* | MG661601* | MG661657* | MG661680* |
G. hieracioides (Kunth) Zardini | Peru | J. Campos 5255 (US) | N | MG661600* | N | N |
Amblysperma scapigera Benth. | Australia | A. Morrison s.n. (US) | MG661713* | MG661612* | N | MG661689* |
Adenocaulon chilense Less. | Chile | G.L. Sobel 2558 (US) | MG661714* | N | N | MG661690* |
Gerbera maxima Beauverd | India | F. Kingdom 18199 (NY) | KX349402 | N | KX349371 | N |
G. gossypina Beauverd | India | W. Koelz 4294 (US) | GU126777 | N | N | GU126755 |
Adenocaulon chilense Less. | Argentina | J.M. Bonifacino 3997 (LP) | KX349359 | N | KX349360 | N |
Chaptalia nutans (L.) Polák | Argentina | P.M. Simon 477 (US) | GU126772 | N | N | GU126751 |
C. pringlei Greene | Mexico | G. Nesom 4405 (US) | GU126773 | N | N | N |
C. runcinata Kuntze | Argentina | P.M. Simon 415 (US) | GU126774 | N | N | GU126752 |
C. chapadensis D.J.N. Hind | Argentina | Roque & al. 2188 (ALCB) | KF989508 | N | KF989614 | N |
C. similis R.E. Fr. | Argentina | P.M. Simon 711 (US) | GU126775 | N | N | GU126753 |
C. tomentosa Vent. | USA | V.A. Funk 12303 (US) | GU126776 | N | N | GU126754 |
C. piloselloides (Vahl) Baker | Brazil | E. Pasini 1021 (ICN) | KX349357 | N | KX349358 | KX349403 |
Trichocline auriculata Hieron | Argentina | H. Simón & J.M. Bonifacino 633 (US) | KX349386 | N | KX349387 | N |
T. catharinensis Cabrera | Brazil | E. Pasini 915 (ICN) | KX349388 | N | KX349389 | KX349411 |
T. caulescens Phil. | Chile | V.A. Funk & al. 13055 (US) | KX349390 | N | KX349391 | KX349406 |
T. cineraria Hook. & Arn. | Argentina | E. Pasini & F. Torchelsen 1027 (ICN) | KX349392 | N | KX349393 | KX349407 |
T. plicata Hook. & Arn. | Argentina | E. Pasini & F. Torchelsen 1023 (ICN) | KX349396 | N | KX349397 | KX349409 |
T. reptans (Wedd.) Hieron | Argentina | E. Pasini & F. Torchelsen 1025 (ICN) | KX349398 | N | KX349399 | KX349410 |
Adaxial leaf epidermal morphology. Lamina (0.5–1.0 cm2) were placed with the adaxial side exposed on carbon tape over stubs for the scanning electron microscopy (SEM), without soaking the material in different solutions prior to SEM. The stubs bearing leaves were treated with gold-palladium to 16.6 μm thickness and were examined under a Philips XL-30 scanning electron microscope at the SEM Lab of the National Museum of Natural History (NMNH). The 22 samples were subsequently observed and photographed under SEM. Images of the leaves were captured using the proprietary software associated with the Philips SEM. Images of at least 15 different areas of the adaxial leaf surface were captured.
Floret morphology. The florets and scapes of 20 herbarium specimens were examined in the United States National Herbarium, Smithsonian Institution, using an optical microscope.
DNA extraction, amplification and sequencing. The molecular work was performed in the Laboratory of Analytical Biology (LAB) of NMNH (Smithsonian Institution). DNAs of 16 samples (15 species, including two samples of Gerbera hieracioides) were extracted using the AutoGen. Herbarium leaf samples, along with 1.0 and 2.3 mm diameter beads, were dipped in liquid nitrogen then immediately shaken for 30 seconds at 18000 rpm. About 500 ml of CTAB was added to the tubes, vortexed and incubated overnight (500 rpm at 45 °C). Then 300 µl of the supernatant was transferred to an AutoGen plate. AutoGen was run according to the manufacturer’s default settings (AutoGen, Inc., Holliston, MA, USA).
Four markers including two nuclear ribosomal (ITS and ETS) and two chloroplast intergenic spacers (trnL–trnF and trnL–rpl32) were amplified. The ITS primers were designed by
Marker | Primers and sequences 5′–3′ | PCR protocol: initial pre-heating; DNA denaturation; primer annealing; DNA extension; final extension |
---|---|---|
ITS | ITS5A: GGAAGGAGAAGTCGTAACAAGGITS4: TCCTCCGCTTATTGATATGC | 95 °C 1 min; 54 °C 1 min; 72 °C 1 min; 72 °C 10 min; 40 cycles |
ETS | 18s-ETS: ACTTACACATGCATGGCTTAATCTETS-Hel-1: GCTCTTTGCTTGCGCAACAACT | 94 °C 0:30 min; 60 °C 0:40 min; 72 °C 1:20 min; 72 °C 5 min; 30 cycles |
trnL–trnF | trnL-Fc: CGAAATCGGTAGACGCTACGtrnL-Ff: ATTTGAACTGGTGACACGAG | 94 °C 1 min; 53 °C 1 min; 72 °C 2 min; 72 °C 10 min; 35 cycles |
trnL–rpl32 | trnL: TACCGATTTCACCATAGCGGrpl32: AGGAAAGGATATTGGGCGG | 95 °C 3 min; 51 °C 40 s; 72 °C 1:20 min; 72 °C 5 min; 40 cycles |
The cycle sequencing programme was 30 cycles of 95 °C for 30 s, 50 °C for 30 s and 60 °C for 4 min. The resultant product was sephadex filtered and sequenced through an ABI 3730 automated sequencer (Applied Biosystems, Foster City, USA). The PCR reactions were performed in a Veriti PCR Thermal Cycler. The amplification protocols for all markers are summarised in Table
A total of 37 sequences of 16 species were retrieved from NCBI for the related taxa within the tribe Mutisieae (Table
Adaxial leaf epidermal morphology. The results of the SEM work (Table
Adaxial leaf epidermal surface morphology of Gerbera hieracioides and the related species. A G. ambigua (sect. Lasiopus) B G. piloselloides (sect. Piloselloides) C G. crocea (sect. Gerbera) D G. perrieri (sect. Pseudoseris) E G. maxima (sect. Isanthus) F Chaptalia pringlei G G. hieracioides H Trichocline catharinensis. Arrows point to the soft thin trichomes. Scale bar=50 μm.
Scape and floret morphology. The results (Table
Scape and floret morphology of Gerbera hieracioides and the related species. A G. jamesonii (sect. Lasiopus) B G. ambigua (sect. Lasiopus) C G. cordata (sect. Piloselloides) D G. crocea (sect. Gerbera) E G. nivea (sect. Isanthus) F G. gossypina (sect. Isanthus) G G. hieracioides (Ecuador) H G. hieracioides (Peru) I Chaptalia meridensis J C. mandonii. The arrows mark the styles of inner ray florets.
Phylogenetic analysis. The MrBayes analysis of the combined nuclear markers and two plastid genes showed four clades of the sampled species of the Gerbera-complex, all with a strong biogeographic signal (Fig.
Both samples of Gerbera hieracioides were nested within the Chaptalia clade. Gerbera hieracioides is sister to Chaptalia pringlei; then the G. hieracioides-C. pringlei clade is sister to the other Chaptalia species with strong support (posterior probability of 1.00). Therefore, the molecular data also support the placement of G. hieracioides in Chaptalia.
The molecular phylogeny of the Gerbera-complex showed that G. hieracioides did not group with Trichocline (Fig.
The confusion about the placement of Gerbera hieracioides is no doubt the result of the morphology falling between that of Gerbera and Chaptalia. A good case concerning this point is the inner ray florets of the trimorphic capitula: Gerbera has a corolla as long as the style or longer and the staminodes are present, whereas Chaptalia has the corolla shorter than the style and without staminodes (
Chaptalia is a New World genus and contains about 70 species in the Americas (
As for Gerbera, this study showed that it falls into two distinct clades, one from Africa which is the sister group of the Australian genus Amblysperma and the other contains all the Asian Gerbera (Fig.
Basionym: Onoseris hieracioides Kunth, Nov. Gen. Sp. [H. B. K.] 4 (ed. folio): 5, Tab. 304. 1818; 4 (ed. quarto): 7, Tab. 304. 1820. Type: Ecuador: “Alousi”, A.J.A. Bonpland 3233 (Lectotype: P00322236, here designated).
Trichocline peruviana Hieron., Bot. Jahrb. Syst. 21: 368. 1895. [according to IPNI]
Trichocline hieracioides (Kunth) Ferreyra, J. Arnold Arbor. 25: 394. 1944, comb. illeg. non Baker (1884).
Gerbera hieracioides (Kunth) Zardini, Bol. Soc. Argent. Bot. 16(1–2): 105. 1974.
Trichocline beckerae (as ‘beckeri’) H.Rob., Phytologia 65(1): 47. 1988.
The placement of Gerbera hieracioides within Chaptalia is strongly supported by both the molecular sequence data (two nuclear markers ITS and ETS and two chloroplast markers trnL–trnF and trnL–rpl32) and the morphology of the scape, capitula and the leaf adaxial epidermal surface. Therefore, Gerbera hieracioides has been transferred to Chaptalia and it is recognised as Chaptalia hieracioides (Kunth) X.-D. Xu et W. Zheng.
This work was supported by the National Natural Science Foundation of China (no. 31560086), the China Scholarship Council, the Social Science Foundation of Kunming University of Science and Technology (no. kkz3201655009) and the Laboratory of Analytical Biology of the Smithsonian Institution. We are grateful to Marinda Koekemoer (South African National Biodiversity Institute) and Yousheng Chen (Institute of Botany, the Chinese Academy of Sciences, China) for providing samples and AJ Harris, Stanley Yankowski, Scott Whittaker, Carol Kelloff, Harold Robinson and Gabriel Johnson (all of the Smithsonian Institution) and Yuan Xu (South China Botanical Garden, China), Sayed Afzal Shah (Quaid-i-Azam University, Pakistan) and Zhumei Ren (Shanxi University, China) for their assistance with experiments, data analyses and helpful discussions. We also appreciate the suggestions and advice from two reviewers and the subject editor Alexander Sukhorukov.