Research Article
Print
Research Article
Mallotus thinii (Euphorbiaceae), a new species discovered from the coastal areas of the south-central provinces of Vietnam
expand article infoNguyen Thi Kim Thanh, Nguyen Diep Anh, Tran Thi Thuy Anh, La Thi Thuy, Nguyen Anh Duc, Tran Duc Long, Van-Son Dang§
‡ University of Science, Vietnam National University, Hanoi, Vietnam
§ Institute of Life Sciences, Vietnam Academy of Science and Technology, Ho Chi Minh, Vietnam
Open Access

Abstract

Mallotus thinii Kim Thanh & V.S.Dang, a new species discovered in coastal areas of the south-central provinces of Vietnam, is described and illustrated here. This species is morphologically most similar to M. leptostachyus Hook.f. and M. peltatus (Geiseler) Müll.Arg. It can be distinguished from other Mallotus species previously known by its habitat on sandy soils close to the beach, shrubby habit, deciduous stipules, oblanceolate leaf blades, two larger extrafloral nectaries near the base or sometimes two to four more along the midrib, presence of a pistillode, and fruits without spines. A detailed description, color photographs, distribution, habitat, preliminary conservation assessment, and phylogenetic analysis are provided. Molecular phylogenetic analyses based on matK and ITS nucleotide sequences strongly confirm M. thinii as a distinct new species within Mallotus.

Key words:

Botanical inventory, Indochina, Khanh Hoa, Quang Ngai, taxonomy

Introduction

Mallotus Lour. is a large genus of Euphorbiaceae, including about 150 species of trees and shrubs that are mainly found in tropical and subtropical regions in Asia, along with a few species in tropical Africa and Madagascar (Sierra et al. 2010). The genus was described by Loureiro (1790) with the type species Mallotus cochinchinensis (= Mallotus paniculatus (Lam.) Müll.Arg.). After a revision by Pax and Hoffmann (1914) with 10 sections and then Airy Shaw (1968) with eight sections, recent morphological and molecular studies by Sierra et al. (2010) suggested that Mallotus s. str. was polyphyletic, in which Mallotus sect. Mallotus, sect. Polyadenii Pax & K.Hoffm., and sect. Stylanthus Pax & K.Hoffm. are monophyletic, while sect. Axenfeldia (Baill.) Pax & K.Hoffm. and sect. Rottleropsis Müll.Arg. are polyphyletic, and sect. Philippinenses Pax & K.Hoffm. is paraphyletic.

In the recent taxonomic revision of Euphorbiaceae for Vietnam, Thin (2007) reported that Mallotus s. l. comprised 33 species (excluding the recently synonymized M. oblongifolius), two subgenera (Coelodiscus (Baill.) Thin and Mallotus Müll.Arg.), and six sections (Axenfeldia (Baill.) Pax & K.Hoffm., Hancea Pax & K.Hoffm., Rottleropsis Müll.Arg., Philippinenses Pax & K.Hoffm. (former sect. Rottlera), Stylanthus Pax & K.Hoffm., and Mallotus Pax & K.Hoffm.). Three new species, Mallotus phongnhaensis Thin & Kim Thanh, M. ninhthuanensis V.S.Dang, Bao & Tagane, and M. vinhhyensis V.S.Dang, Tagane & Tk.Yamam., and two new records, M. leptostachyus Hook.f. and M. cordatifolius Slik, have been reported, increasing the total number of species in Vietnam to 38 (Nguyen and Nguyen 2008; Nguyen et al. 2010; Nguyen and Nguyen 2014; Dang et al. 2025).

In 2007, Nguyen Nghia Thin of VNU University of Science collected unknown Mallotus specimens from Binh Dinh Province and deposited them in the HNU Herbarium. Then, in 2018, during a botanical survey conducted in the south-central provinces of Vietnam, the authors discovered wild-growing individuals of this species. The plants, including both male and female individuals, were found along the hedges of local houses and scattered within a nearby area along Sa Huynh Beach, Quang Ngai Province. After six years, in 2023, one more population was discovered along the roadside on Binh Ba Island, Khanh Hoa Province. After morphologically comparing the available herbarium specimens and reviewing relevant literature, these specimens did not match any previously described species. The results led to the conclusion that it was an entirely new species, described here as Mallotus thinii Kim Thanh & V.S.Dang.

Materials and methods

Morphology

The specimens were compared with similar species through a review of taxonomic literature from Vietnam and neighboring areas in Asia (Gagnepain 1925; Ho 1999; Thin 2007; Kiu and Gilbert 2008; van Welzen and Chayamarit 2020) and by examining dried specimens from Vietnamese herbaria (e.g., HNU, NIMM, HN, and VNM) and online digitized images of type specimens available at herbaria such as K and P and websites including Tropicos (https://www.tropicos.org/), Chinese Virtual Herbarium (https://www.cvh.ac.cn/), POWO (https://powo.science.kew.org/), and Asian Plant (https://asianplant.net/).

Measurements with an accuracy of 0.5 mm and descriptions are based on fresh and dried material. The scientific names and terminology follow Turland et al. (2018) (Shenzhen Code), Sierra et al. (2005), and Beentje (2010). Color photographs and images of dried specimens were captured using an Olympus Tough TG-5 camera. Samples for micromorphological details, including pistillate and staminate flowers, pistillodes, and stamens, were fixed and then submerged in water for imaging with a Nikon Z6ii camera and a Nikkor 180 mm f/2.8 AIS lens coupled with a reversed Nikkor AF 50 mm f/1.8D lens. Focus stacking (Helicon Focus) was applied to optimize the micromorphological images.

The conservation assessment is based on the recommendations of the Guidelines for Using the IUCN Red List Categories and Criteria (2024).

Taxon sampling and DNA analysis

The taxon sampling included 47 sequence-available species of Mallotus, nine individuals of the new species, and Macaranga tanarius as an outgroup. Taxon names, voucher information, and GenBank accession numbers of the samples used in this study are listed in Table 1 and Table 2. The genetic markers matK and ITS were selected based on their previous use and informativeness in earlier studies (Sierra et al. 2010).

Table 1.

GenBank accession numbers of reference sequences (- sequences not available).

No. Taxon sampled matK ITS
1 Mallotus apelta KP093309.1, KP093310.1 KP092931.1, KP092932.1
2 M. aureopunctatus MG762732.1
3 M. barbatus EF582633.1 DQ866591.1, KP092933.1
4 M. brachythyrsus EF582634.1 DQ866592.1
5 M. caudatus EF582636.1 DQ866593.1
6 M. claoxyloides EF582639.1 DQ866594.1
7 M. connatus EF582640.1
8 M. cumingii EF582642.1 DQ866625.1
9 M. decipiens EF582644.1 DQ866595.1, DQ866596.1
10 M. discolor EF582645.1 DQ866597.1
11 M. eucaustus DQ866598.1
12 M. ficifolius EF582647.1 DQ866599.1
13 M. floribundus AJ275677.1
14 M. garrettii KR531147 KR532328.1, KR532329.1
15 M. glabriusculus AB924698.1
16 M. griffithianus LC737079.1 DQ866600.1
17 M. hookerianus KP093997.1, KP093998.1 KP092934.1, KP092935.1
18 M. japonicus AB268027.1, EF582649.1 MT444827.1, MT444828.1
19 M. khasianus EF582650.1 DQ866601.1
20 M. korthalsii EF582651.1, LC737080.1
21 M. lackeyi EF582652.1 AJ298261.1, DQ866602.1
22 M. leptophyllus LC737081.1
23 M. leucocalyx EF582654.1 DQ866603.1
24 M. macrostachyus EF582656.1 DQ866604.1
25 M. miquelianus EF582661.1 DQ866605.1
26 M. mollissimus EF582662.1, LK021464.1
27 M. nanus AB925120.1
28 M. nudiflorus EF582667.1, EF582668.1 DQ866627.1, DQ866628.1
29 M. oppositifolius EF582669.1 DQ866606.1
30 M. pallidus EF582670.1 DQ866607.1
31 M. paniculatus EF582671.1, KP093433.1 DQ866608.1, DQ866609.1
32 M. peltatus EF582672.1, MN885802.1 DQ866610.1
33 M. penangensis DQ866611.1
34 M. philippensis EF582674.1, KP093510.1 DQ866614.1, KP092939.1
35 M. pierrei EF582675.1 DQ866615.1
36 M. pleiogynus EF582676.1
37 M. polyadenos EF582677.1 DQ866616.1
38 M. repandus EF582678.1, LC506375.1 DQ813305.1, DQ866617.1
39 M. resinosus EF582679.1 DQ866618.1
40 M. rhamnifolius EF582680.1 DQ866619.1
41 M. rufidulus DQ866620.1
42 M. spinulosus DQ866532.1
43 M. subpeltatus DQ866621.1
44 M. subulatus DQ866622.1
45 M. tetracoccus EF582683.1 MG762734.1
46 M. thorelii DQ866624.1
47 M. tokiae LC498618.1 LC498619.1
48 Macaranga tanarius EF582630.1 DQ866585.1
Table 2.

Voucher information and GenBank accession numbers of nine individuals sequenced of the new species, Mallotus thinii.

No. Voucher specimens Locality GenBank accession numbers
matK ITS
1 KT230507-03 Vietnam, Quang Ngai Province, Sa Huynh Commune PV658520 PV920206
2 KT230507-05 PV658521 PV920207
3 KT230507-06 PV658522 PV920208
4 KT230507-07 PV658523 PV920209
5 KT230507-08 PV658524 PV920210
6 KT230507-10 PV658525 PV920211
7 KT230507-11 PV658526 PV920212
8 KT230507-12 PV658527 PV920213
9 KT230830-04 Vietnam, Khanh Hoa Province, Nam Cam Ranh Commune, Binh Ba Island PV658528 PV920214

Total DNA was extracted from leaf tissue using an SDS-based protocol (Liu et al. 2000). Amplifications were carried out in 30 µl reactions containing PCR Mastermix 2× (Vazyme Biotech, China), 0.4 µM of each primer, 1.2 µl template DNA, and nuclease-free water. The matK or ITS region was amplified using primer pairs 5′TCAAATCCTTCGCTATTGGG3′/5′GCGAAATAGAAGAAACTCTTGG3′ or 5′GTAACAAGGTTTCCGTAGGTG3′/5′TGATATGCTTAAACTCAGCGG3′, respectively. The PCR program consisted of an initial denaturation for 5 min at 95 °C, followed by 35 cycles of 20 s denaturation at 95 °C, 20 s annealing at 50 °C, and 45 s extension at 72 °C, with a final extension of 3 min at 72 °C. Sanger sequencing was performed by the 1st Base Company (Selangor, Malaysia). Chromatograms were checked using SnapGene Viewer, and unreliable nucleotide reads were trimmed.

Multiple sequences of each marker were aligned using the ClustalW multiple alignment tool integrated in BioEdit (Hall 1999) with default settings. Sequence ends were manually trimmed, and the two markers were concatenated into a single alignment. The p-distance among samples was estimated using MEGA 11 (Tamura et al. 2021). Substitution models were analyzed with jModelTest 2 (Darriba et al. 2012) for each marker. Based on the BIC score, GTR was selected for matK and GTR+I+G for ITS. Phylogenetic trees were reconstructed using matK, ITS, and combined matK+ITS sequences through Bayesian inference (BI) in MrBayes v3.2 (Ronquist et al. 2012) under default parameters. For each analysis, two independent runs were performed for 20,000,000 generations, with sampling every 500 generations. Chains, temperature, number of branch swaps, and swap frequencies were set to default. Trees were sampled every 500 generations, the initial 25% of sampled trees were discarded as burn-in, and the resulting trees were visualized using FigTree (v1.4.4).

Taxonomic treatment

Mallotus thinii Kim Thanh & V.S.Dang, sp. nov.

Figs 1, 2

Type.

Vietnam • Quang Ngai province, Sa Huynh commune, on sandy soils, at the hedge of local people’s houses, 100 meters from the beach, close to Ganh Mountain, 14°38'12.1"N, 109°04'01.4"E, 07 May 2023, Kim Thanh KT230507-03 (holotype: HNU024793!).

Figure 1. 

Mallotus thinii Kim Thanh & V.S.Dang. A. Habit of new species at the type locality; B. Leaves adaxial surface; C. Leaves abaxial surface; D. Staminate inflorescence; E. Pistillate inflorescence; F. Extrafloral nectaries along midrib (arrows); G. Staminate flower; H. Pistillate flowers; I. Infructescence with fruits; J. Fruit with sepals persistent (all photos by Nguyen Thi Kim Thanh).

Diagnosis.

The new species is similar to M. leptostachyus Hook.f. and M. peltatus (Geiseler) Müll.Arg. in shrub habit, in having alternate to opposite leaves, indumentum of simple and stellate hairs and yellow glandular scales, leaf margin with denticulate glandular teeth, racemose and unbranched inflorescences. However, it can be fully distinguished from those by the deciduous stipules (vs. present), oblanceolate leaf blade (vs. ovate to obovate in M. peltatus, and elliptic in M. leptostachyus), penninerved veination (penninerved or palmate in M. peltatus, and triplinerved in M. leptostachyus), extrafloral nectaries two larger near the base or sometimes 2–6(–8) along midrib (vs. 2–6 small one in M. peltatus and two in M. leptostachyus), stamens 28–33 (vs. 25–35 in M. peltatus and c. 60 in M. leptostachyus), pistillate flower with sepal 3 (vs. calyx urceolate, caducous in M. peltatus), short style up to 0.4 mm long (vs. 2.8–4.5 mm long in M. peltatus, c. 0.2 mm in M. leptostachyus), fruits without spines (vs. with spines in M. peltatus).

Figure 2. 

The dried flowers of Mallotus thinii Kim Thanh & V.S.Dang. A. Staminate flower in bud; B. Staminate flower when open; C. Stamens with separated thecae; D. Pistillode; E. Pistillate flower; F. Dried fruit without spine; G. Valves and seeds from dehisced capsule; H. Brown seeds (photos taken by Nguyen Thi Kim Thanh and Nguyen Thanh Son).

Description.

Dioecious shrubs, rarely monoecious, 0.8–1.5 m tall. Young branches flattened, matured branches roundish with longitudinal ridges. Indumentum pubescent on most young parts and inflorescences, composed of simple and stellate hairs and yellow glandular scales. Stipules subulate, c. 2.2 mm long, pubescent outside, deciduous. Leaves simple, alternate, apically opposite, or whorled; blade oblanceolate to rarely narrow elliptic; 9.7–13.5 × 3.2–4.7 cm; apex bluntly apiculate up to 0.7 cm long; base truncate or slightly cordate, margin dentate for distal 1/2 to 2/3rd, with distal-pointing glandular teeth; upper and lower surfaces become glabrous at maturity; venation penninerved, nerves 6–8 per side, lateral vein angle from 25–30°, looped and joined at 1–3 mm from the margin; extrafloral nectaries 2, on basal nerves, elliptic, 1–1.5 × 0.3–0.5 mm, on the upper surface, sometimes 2–6(–8) extra ones, elliptic to orbicular, ca. 0.4 × 0.2–0.4 mm, along midrib, near the base; petiole sulcate, 0.5–3 cm long, covered with stellate hairs. Inflorescences erect, terminal to axillary, unbranched, pubescent with yellow glandular scales, petals, and disc absent. Staminate inflorescence racemes, up to 11 cm long, flowers in groups of up to eight per node; bracts triangular, c. 1 × 0.8 mm. Staminate flowers pedicels 1.3–1.5 mm long; sepal 3–4, free, ovate, c. 1.7 mm long, densely covered with stellate hairs outside and yellow glandular scales outside and inside; stamens 28–33, filaments 1–1.5 mm, thecae two separated by broad connective, ovoid to ellipsoid, 0.2–0.25 × 0.15–0.2 mm, extrorse, opening lengthwise; pistillode present, consisting of 2–3 wart-like appendices. Pistillate inflorescences racemose, up to 9 cm long, bracts triangular, c. 0.8 × 1 mm. Pistillate flowers c. 1.5 mm in diameter; pedicel up to 1 mm long; sepal 3, ovate, ca. 1 mm long, free; ovary 3-locular, hairy, green; style absent to 0.4 mm long; stigmas 3, plumose, up to 1.5 mm long, persistent. Infructescence up to 17 cm long, peduncle 2–3 cm long. Fruits 3-lobed capsules, curved downward when mature, green, subglobose (slightly flattened dorsiventrally), without spines, 0.8–1.2 mm in diameter, 3-locular, densely hairy, and yellow glandular scales, opening into three valves, septicidally and incompletely loculicidally from the base, each valve slightly flattened dorsoventrally, wall ca. 0.7 mm thick. Seeds subglobose, ca. 5 × 4 × 5 mm, ecarunculate, surface smooth, brown.

Flowering and fruiting.

Flowering from April to October and fruiting from May to November.

Distribution.

This species is known from the coastal areas of south-central Vietnam: Sa Huynh beach in Sa Huynh commune, Quang Ngai province; Dang Vinh Loi beach of Phu My commune, Binh Dinh province; and Binh Ba Island of Nam Cam Ranh commune, Khanh Hoa province (Fig. 3).

Figure 3. 

Geographical distribution of Mallotus thinii Kim Thanh & V.S.Dang (pink triangles; map created with http://www.simplemappr.net).

Habitat.

Mallotus thinii grows on sandy soils near the sea, characterized by poor soil fertility, frequent strong sunlight, drought, and wind. This species is distributed at altitudes up to 100 m.

Vernacular.

The new species was discovered at three locations, all of which are near the sea. To clarify the difference in habitat with other species within the genus Mallotus, we propose the Vietnamese common name “Ruối biển Thìn”.

Etymology.

The species is named in honor of Professor Nguyen Nghia Thin from VNU University of Science, who devoted his career to revising the Euphorbiaceae of Vietnam.

Uses.

No known uses.

Other specimen examined.

Vietnam • Quang Ngai province, Sa Huynh commune, on sandy soils in the local cemetery closed to the beach, 14°38'10.5"N, 109°03'59.5"E, 07 Oct 2018, Kim Thanh KT181007-12 (HNU!) • Binh Dinh province, Phu My commune, Dang Vinh Loi beach, 14°07'42.3"N, 109°12'42.5"E, 22 Jun 2007, Thin N.N. NT070622-17 (HNU!) • Khanh Hoa province, Nam Cam Ranh commune, Binh Ba Island, 11°50'07.7"N, 109°14'43.0"E, elevation 100 m, 30 Aug 2023, Kim Thanh KT230830-04 (HNU!, VNM!).

Preliminary conservation status.

Data deficient (DD). Mallotus thinii was recorded from three populations in three different provinces, including Quang Ngai, Binh Dinh, and Khanh Hoa. All populations are located outside protected areas and near beaches or tourist areas where there is a high risk of land use change or human impact. At Sa Huynh beach in Quang Ngai, there are only a few restaurants and seafood farms serving tourists, and finally close to Ganh Mountain (14°37'58.9"N, 109°04'06.0"E) is a local cemetery. About 20 individuals were observed. We interviewed local people and learned that there is a larger population near Ganh Mountain. The presence of young individuals in this population is an indicator of the possibility of sexual reproduction process is normal and ongoing. Although we have not had the opportunity to explore that mountain, we believe that the number of individuals in this area is much larger than what we observed. In Dang Vinh Loi beach (Binh Dinh province) and Binh Ba Island (Khanh Hoa province), each population contained approximately 30 individuals. Although these populations are potentially endangered because they are not located in a protected area, from what has been observed and what information is available, this species has adapted very well to the dry conditions of the sand beach and the hot, dry climate of the south central region. According to insufficient information on distribution range and population size, this species can be qualified as Data deficient (DD) (IUCN 2024).

A key to the species of Mallotus in Vietnam

1 Leaves opposite, longer than large, pinnatinerved, rarely trinerved or palmate; pistillodes present in male flowers 2
Leaves large-triangular or rhombic-ovate, alternate, palmately nerved or trinerved; pistillodes absent 22
2 Two leaves of each pair similar, not reduced 3
One leaf of each pair stipule-like 19
3 Leaves pinnately nerved or rarely triplinerved with weak basal nerves 4
Leaves palmatinerved or triplinerved 10
4 Inflorescences cauliflorous on the lower stem M. phongnhaensis
Inflorescences axillary or terminal 5
5 Leaves without puncti-glandules beneath (domatia) 6
Leaves puncti-glandular beneath 9
6 Two black extrafloral nectaries at the leaf base M. hanheoensis
Without extrafloral nectaries at the leaf base 7
7 Fruits without dense and long spines at the top M. poilanei
Fruits sparse and short hairs 8
8 Fruits with long and dense hairs; leaf-margins undulate M. eberhardtii
Fruits with sparse spines at the top; leaf-margins dentate M. sathayensis
9 Leaves obovate, with six pairs of nerves; male inflorescences few-flowered M. yunnanensis
Leaves oblanceolate, with more than eight pairs of nerves; male inflorescences many-flowered M. resinosus
10 Leaves oblong, lanceolate or oblanceolate 11
Leaves large-ovate, oval or obovate 15
11 Leaves weakly triplinerved, glabrous; fruits yellow, glandular with hairs inside the fruit wall M. lanceolatus
Leaves not above 12
12 Leaves rhombic or lanceolate or oblanceolate, coarsely dentate halfway from apex; leaf lower surface, male and female sepals covered with yellow glandules; tertiary veins parallel and clearly raised below M. decipiens
Leaves oblong, long-lanceolate or long-oblanceolate, entire; leaf lower surface, male and female sepals eglandular (except Mallotus canii), tertiary veins sparse and not raised beneath 13
13 Filaments glabrous; stipules caducous; young branchlets covered with lepidote scales; male buds obovoid M. canii
Filaments pubescent; stipules 4–5 mm long; young branchlets glabrous; male buds globose 14
14 Male flowers sepals 3, coriaceous, stipules present M. glabriusculus
Male flowers sepals 5, chartaceous; stipules deciduous M. pierrei
15 Fruits spinous, whitish stellate hairs M. coudercii
Fruit densely echinate 16
16 Leaves coriaceous, densely pubescent; fruits slender echinate; pistillodes large 17
Leaves membranous, glabrous; fruits sparsely strong echinate; pistillodes reduced 18
17 Filaments pubescent, sepals 3; stamens 25; pistillode flat-globose M. chuyenii
Filaments glabrous, sepals 4–5; stamens 50; pistillode cup-shaped M. ustulatus
18 Male and female flower sepals pubescent; filaments pubescent M. glabriusculus
Male and female flower sepals glabrous; filaments glabrous M. nanus
19 Fruit smooth, without spines M. ninhthuanensis
Fruit echinate 20
20 Reduced leaves suborbicular M. vinhhyensis
Reduced leaves narrowly triangular 21
21 Non-reduced leaf base rounded to obtuse M. hookerianus
Non-reduced leaf base deeply cordate, sometimes half-surrounding the stem M. cordatifolius
22 Fruits smooth; leaves almost epeltate, glandular-granular beneath 23
Fruits echinate; leaves peltate, rarely epeltate 29
23 Ovary 2-locular M. repandus
Ovary 3-locular 24
24 Leaves large-ovate 25
Leaves long-ovate to oval or oblanceolate 26
25 Fruits ca. 10 mm in diameter, yellow; leaves coriaceous with several extrafloral nectaries marginal in the lower half; climbing shurbs M. contubernalis
Fruits ca. 5 mm in diameter, green; leaves chartaceous with extrafloral nectaries at leaf base; erect shrubs M. microcapus
26 Fruit and leaf lower surface covered with red glandular-granules, two extrafloral nectaries next to the basal nerves M. philippinensis
Fruit and leaf lower surface not covered with red glandular granules, two extrafloral nectaries on the basal nerves 27
27 Indumentum composed of stellate hairs; stipules 3–6 mm long; pistillate flower sepals 4–5; fruits yellowish M. pallidus
Indumentum composed of simple and stellate hairs; stipule less than 2.5 mm long; pistillate flower sepals 3; fruits green 28
28 Stipules narrowly triangular, caducous; stamens ca. 60 M. leptostachyus
Stipules subulate, deciduous; stamens 28–33 M. thinii
29 Leaves narrowly peltate or epeltate; male flower sepals deciduous; stamens 17–42; fruits less than 1 cm in diameter 30
Leaves peltate, large ovate; male flower sepals persistent; stamens >45; fruits exceeding 1 cm in diameter 33
30 Branchlets and leaves glabrous M. floribundus
Branchlets and leaves pubescent 31
31 Leaves epeltate M. nepalensis
Leaves peltate 32
32 Leaves narrow-ovate, not whitish-punctate on the upper surface; margin nearly entire M. peltatus
Leaves large-ovate, densely whitish-punctate on the upper surface; margin dentate M. thorelii
33 Fruits sparsely echinate 34
Fruits densely echinate ± forming a continuous layer 36
34 Leaves with brown to yellow beneath M. japonicus
Leaves with white beneath 35
35 Shrubs or small trees; inflorescences slender, often single or few-branchlets at the basal part, white pubescent; fruits densely whitish echinate M. apelta
Trees; inflorescences largely paniculate, brownish pubescent; fruits distantly brown echinate M. paniculatus
36 Leaves subpeltate; fruits robust-shortly echinate M. macrostachyus
Leaves peltate; fruits flocculently echinate 37
37 Leaves grey-yellow, large peltate, blade loped; indumentum composed of densely floccose-tomentose M. barbatus
Leaves narrow peltate, blade entire or rarely lobed, thick and rigid when dry; indumentum composed of red-brown hairs 38
38 Infructescence sparsely including fruits with distantly spines M. metcalfianus
Infructescence densely including fruits with long straight spines M. mollissimus

Discussion

Morphological

Mallotus thinii occupies a different habitat from other species in Vietnam, namely sandy soils close to the beach. Moreover, it is morphologically distinguished from most of the other previously known Mallotus species in Vietnam and nearby areas by the combination of the following morphological features: shrubby habit, deciduous stipules, oblanceolate leaf blades, two larger extrafloral nectaries near the base or sometimes two to four more along the midrib, presence of a pistillode, and fruits without spines. In terms of vegetative morphology, this species could most easily be confused with M. peltatus because of its similar leaf arrangement, leaf shape, leaf venation, and extrafloral nectaries (Table 3). However, its female reproductive organs are similar to those of M. leptostachyus, which has fruits that are densely hairy and lack spines (Table 3).

Table 3.

Comparison of Mallotus thinii with morphologically most similar species (modified from Gagnepain 1925, Ho 1999, Kiu and Gilbert 2008, and van Welzen and Chayamarit 2020).

Characters M. thinii M. leptostachyus M. peltatus
Habit shrubs shrubs to trees small trees or shrubs
Stipules deciduous persistent persistent
Leaf blades oblanceolate to rarely narrow elliptic elliptic ovate to obovate
Venation penninerved tripinerved penninerved or palmate
Extrafloral nectaries 2 larger glands near the base and sometimes 2–6(–8) more along midrib 2 glands near the base 2–6 small glands near the base
Stamens 28–33 c. 60 25–35
Pistillode present present absent
Pistillate flower sepals 3, style absent to 0.4 mm long sepals 3, style c. 0.2 mm long calyx urceolate, caducous, style 2.8–4.5 mm long
Fruit without spines, densely hairy without spines, densely hairy with spines, subglabrous
Seeds subglobose, brown subglobose, brown

The new species described here should be classified in Mallotus Lour. sect. Philippinenses Pax & K.Hoffm., based on shared stellate and simple hairs, yellow glandular scales on most parts, alternate leaves, blades that are not peltate with two basal extrafloral nectaries on the upper surface, unisexual inflorescences, and fruits lacking spines (Sierra et al. 2010). Phylogenetic evidence has indicated that sect. Philippinenses, as presently circumscribed, is not monophyletic (Sierra et al. 2010), and the new species would fall into the “Philippinenses grade,” which comprises basal branches leading to an embedded clade of sect. Mallotus.

Phylogenetic results

Phylogenetic analyses of matK and ITS sequence datasets, either separately or in combination, all resolved the nine samples of the new species Mallotus thinii as a monophyletic clade (BP = 100) distinct from morphologically similar species such as M. peltatus (Figs 46). M. thinii forms a sister clade to the one containing M. pallidus and M. rhamnifolius (Figs 46). However, because of the limited Mallotus matK and ITS sequences available in GenBank, only 30 other Mallotus species were included in the phylogenetic analyses. Therefore, the sister species to M. thinii remains uncertain, and more extensive taxonomic sampling is needed to clarify its evolutionary origin.

Figure 4. 

Bayesian phylogram based on matK sequences.

Figure 5. 

Bayesian phylogram based on ITS sequences.

Figure 6. 

Bayesian phylogram based on combined matK and ITS sequences (numbers above branches are Bayesian posterior probabilities). Macaranga tanarius sequences served as an outgroup.

Acknowledgments

The authors would like to thank Dr. Nguyen Thanh Son, their colleague at Vietnam National University, Hanoi, for his assistance with imaging. Sincere thanks are also extended to the curators and staff of the herbaria HNU, HN, NIMM, VNM, K, and P for making their materials accessible.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Use of AI

No use of AI was reported.

Funding

This research was conducted under the research project QG23.01 of Vietnam National University, Hanoi.

Author contributions

Data curation: NTKT. Investigation: NTKT, NDA, TTTA, LTT, NAD. Methodology: NTKT, TDL, VSD. Writing – original draft: NTKT. Review and manuscript correction: NTKT, VSD.

Author ORCIDs

Nguyen Thi Kim Thanh https://orcid.org/0000-0003-2948-6385

Nguyen Diep Anh https://orcid.org/0009-0000-5370-6048

Tran Thi Thuy Anh https://orcid.org/0009-0004-6170-4666

La Thi Thuy https://orcid.org/0009-0007-8784-4597

Nguyen Anh Duc https://orcid.org/0009-0008-8938-1343

Tran Duc Long https://orcid.org/0000-0001-9232-0244

Van-Son Dang https://orcid.org/0000-0001-8681-4141

Data availability

All data supporting the findings of this study are available in a public database (GenBank), as specified in the main text.

References

  • Beentje H (2010) The Kew Plant Glossary: An Illustrated Dictionary of Plant Terms. Kew Royal Botanic Gardens, Kew.
  • Dang VS, Yamamoto T, Nguyen QB, Pham QT, Truong BV, Nguyen TV, Souladeth P, Kongxaisavat D, Yamazaki K, Tagane S (2025) Two new species of Mallotus (Euphorbiaceae) from Vietnam. Taiwania 70(3): 439–444. https://taiwania.ntu.edu.tw/pdf/tai.2025.70.439.pdf
  • Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: More models, new heuristics and parallel computing. Nature Methods 9(8): 772–772. https://doi.org/10.1038/nmeth.2109
  • Gagnepain F (1925) Euphorbiaceae. In: MH Lecomte, Flore générale de lʼIndo-Chine 5: 350–376. Masson & Cie, Paris.
  • Hall TA (1999) BIOEDIT: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/ NT. Nucleic Acids Symposium Series: 41.
  • Ho PH (1999) An Illustrated Flora of Vietnam. 2: 248–256. [Youth Publ. House, Hanoi, Vietnam.]
  • Kiu HS, Gilbert MG (2008) Mallotus. In: Wu ZY, Raven PH, Hong DY (Eds) Flora of China, vol 11. Science Press, Beijing & Missouri Botanical Garden Press, St. Louis, 225–237.
  • Loureiro J (1790) Flora Cochinchinensis 1: 633–635. [J. de Loureiro, Ulyssipone] [Lisboa]
  • Nguyen TKT, Nguyen NT (2008) Mallotus cordatifolius and Mallotus apelta var. kwangsiensis, new records of Euphorbiaceae for Vietnam. VNU Journal of Science. National Science and Technology 24(2S): 293–397.
  • Nguyen TKT, Nguyen NT (2014) A new species of Mallotus (Euphorbiaceae) from Vietnam. Gardens’ Bulletin (Singapore) 66: 61–65.
  • Nguyen TKT, Nguyen NT, Nguyen TVA (2010) Mallotus leptostachyus Hook.f., a new record of Euphorbiaceae for Vietnam. VNU Journal of Science. Natural Sciences and Technology 26(4S): 639–641.
  • Pax F, Hoffmann K (1914) Euphorbiaceae–Acalypheae–Mercurialinae. In: Engler A (Ed.) Das Pflanzenreich, IV, 147, vii. Wilhelm Engelmann, Leipzig, Berlin, 145–208.
  • Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/SYSBIO/SYS029
  • Sierra SEC, Welzen PC, Slik JWF (2005) A taxonomic revision of Mallotus sect. Philippinenses (former section Rottlera-Euphorbiaceae) in Malesia and Thailand. Blumea 50(2): 221–248. https://doi.org/10.3767/000651905x622978
  • Sierra SEC, Kulju KKM, Fišer Ž, Aparicio M, Welzen PC (2010) The phylogeny of Mallotus s.str. (Euphorbiaceae) inferred from DNA sequence and morphological data. Taxon 59(1): 101–116. https://doi.org/10.1002/tax.591011
  • Thin NN (2007) Taxonomy of Euphorbiaceae in Vietnam: 179–202. Vietnam National University Publishers, Hanoi.
  • Turland NJ, Wiersema JH, Barrie FR, Greuter W, Hawksworth DL, Herendeen PS, Knapp S, Kusber WH, Li DZ, Marhold K, May TW, McNeill J, Monro AM, Prado J, Price MJ, Smith GF [Eds] (2018) International Code of Nomenclature for algae, fungi, and plants (Shenzhen Code). Regnum Vegetabile 159. Koeltz Botanical Books, Glashütten. https://doi.org/10.12705/Code.2018
  • van Welzen PC, Chayamarit K (2020) Flora of Thailand. Euphorbiaceae. Naturalis Biodiversity Center, Leiden; Forest Herbarium, National Park, Wildlife and Plant Conservation Department, Bangkok. www.nationaalherbarium.nl/thaieuph
login to comment