Research Article
Print
Research Article
Diving into Diversity: Haslea berepwari (Bacillariophyceae, Naviculaceae), a new species of marine diatom from New Caledonia
expand article infoFiddy Semba Prasetiya‡, Thierry Jauffrais§, Mustapha Mohamed-Benkada|, Nolwenn Callac§, Dominique Ansquer§, Elif Yılmaz#, Claude Lemieux¤, Monique Turmel¤, Jean-Luc Mouget«, Danang Ambar Prabowo‡, Debora Christin Purbani‡, Diah Radini Noerdjito‡, Varian Fahmi‡, Sulastri Arsad#, Romain Gastineau#
‡ Research Center for Biosystematics and Evolution, Research Organization for Life Sciences and Environment, National Research and Innovation Agency (BRIN), Cibinong, Indonesia
§ Ifremer, IRD, Univ Nouvelle-Calédonie, Univ La Réunion, CNRS, UMR 9220 ENTROPIE, Nouméa, New Caledonia (Fr)
| University Oran1, Oran, Algeria
¶ University of Sciences and Technology- Mohamed Boudiaf, Oran, Algeria
# University of Szczecin, Szczecin, Poland
¤ Université Laval, Québec, Canada
« Le Mans Université, Le Mans, France

Corresponding author: Fiddy Semba Prasetiya ( fidd001@brin.go.id )

Corresponding author: Romain Gastineau ( romain.gastineau@usz.edu.pl )

Academic editor: Bing Liu
© 2025 Fiddy Semba Prasetiya, Thierry Jauffrais, Mustapha Mohamed-Benkada, Nolwenn Callac, Dominique Ansquer, Elif Yılmaz, Claude Lemieux, Monique Turmel, Jean-Luc Mouget, Danang Ambar Prabowo, Debora Christin Purbani, Diah Radini Noerdjito, Varian Fahmi, Sulastri Arsad, Romain Gastineau.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Prasetiya FS, Jauffrais T, Mohamed-Benkada M, Callac N, Ansquer D, Yılmaz E, Lemieux C, Turmel M, Mouget J-L, Prabowo DA, Purbani DC, Noerdjito DR, Fahmi V, Arsad S, Gastineau R (2025) Diving into Diversity: Haslea berepwari (Bacillariophyceae, Naviculaceae), a new species of marine diatom from New Caledonia. PhytoKeys 255: 215-234. https://doi.org/10.3897/phytokeys.255.144697
Open Access

Abstract

The current article introduces and describes Haslea berepwari sp. nov., a new species of diatom discovered in the vicinity of Boulouparis, New Caledonia. Under light microscopy, H. berepwari sp. nov. strongly resembles Haslea pseudostrearia, but preliminary molecular barcoding conducted using partial 18S and rbcL genes suggested that it was a distinct species. This was confirmed first by scanning electron microscopy which showed the differences in stria densities between both species. A short-reads genome-skimming protocol applied on H. berepwari sp. nov. led us to obtain its complete mitochondrial and plastid genomes. The mitogenome is 36,572 bp in length and as already observed among other species of Haslea spp., the nad6 and nad2 genes are fused within a single open-reading frame. The plastome is 131,897 bp length, and unlike the mitogenome, it is not colinear with those of H. pseudostrearia. The results derived from the sequencing of the plastome allowed to perform a 123-gene multigene maximum likelihood phylogeny that associates H. berepwari sp. nov. to H. pseudostrearia with maximum support at the nodes but also strictly distinguishes them, suggesting a greater genetic distance between these species than what has been previously observed between other marennine-producing species.

Key words:

Coral Sea, Naviculales, organellar genomes, tropical diatoms

Introduction

The genus Haslea comprises a group of morphologically diverse pennate diatoms, currently including 36 taxonomically accepted species (Guiry and Guiry 2011). The holotype species of the genus is Haslea ostrearia (Gaillon) Simonsen 1974, also known as the ‘blue diatom’ due to its capacity to produce blue pigment commonly known as marennine (Simonsen 1974). Marennine is responsible for the green coloration observed in the gills of oysters along the Atlantic coast of France (Gaillon 1820; Gastineau et al. 2014). Green oysters, which are distinguished by their specific flavor attributed to modifications in fatty acids and their emerald hue, are less common and command a higher price in the French oyster industry (Prasetiya et al. 2017a). While the chemical structure of Marennine remains unknown, it has been shown to display several biological properties (Pouvreau et al. 2007; Pouvreau et al. 2008; Gastineau et al. 2012b; Prasetiya et al. 2016; Prasetiya et al. 2017b; Prasetiya et al. 2019a; Falaise et al. 2019a, 2019b; Permatasari et al. 2019; Prasetiya et al. 2020a; 2020b; Prasetiya et al. 2021a, 2021b; Seveno et al. 2024). Latest research and development efforts have focused on scaling up the production of the diatom and its pigment (Gargouch et al. 2022; Nghiem Xuan et al. 2021; Adjout et al. 2022; Prasetiya et al. 2022).

In recent years, several new species of Haslea have been described worldwide, some of which also produce blue pigments, while others exhibit shapes unusual for this genus (Poulin et al. 2004; Gastineau et al. 2012a, 2016, 2021b; Talgatti et al. 2014; Sterrenburg et al. 2015; Li et al. 2017; Prasetiya et al. 2019b; Lobban et al. 2020). Among the species that do not produce a blue pigment, Haslea pseudostrearia Massé, Rincé & E.J. Cox 2001 is of particular relevance to the present article. This species was first described by Massé et al. (2001) based on material from the Kingsbridge estuary in southern UK and received its species name due to its morphological similarities with H. ostrearia. Following this initial description, strains of non-blue Haslea were assigned to this species after being reported in various and distant parts of the world, including South Africa (GenBank: OK729589 and OK729583) and the Yellow Sea (An et al. 2017) (GenBank: KY320350 and KY320289).

The present study aims to describe a new species of pennate non-blue diatom from the genus Haslea originating from New Caledonia. New Caledonia, a territorial French collectivity, comprises several archipelagos and isolated islands, some of which are remnants of the Zealandia submerged continent. New Caledonia is situated approximately 1,500 km east of Australia, in the Southwestern Pacific Ocean and its largest island is named Grande Terre (‘great land’). On the west coast of Grande Terre, in Boulouparis, the French national institute for ocean science and technology (Ifremer) has operated a station for experimental aquaculture for approximately 50 years (Galinie 1989) (currently co-operated with the Adecal Technopole) with decades of expertise in shrimps and other crustaceans’ cultivation (e.g. for recent developments Lemonnier et al. 2021; Giraud et al. 2021, 2022; Colette et al. 2022, 2023; Nguyen et al. 2022; Callac et al. 2022, 2023, 2024), including experiments on the co-cultivation of shrimps with holothurians (Purcell et al. 2006; Bell et al. 2007). In 2020, a strain of non-blue Haslea has been isolated from one of the earthen ponds used in these studies. Under light microscopy (LM), the strain looked very similar to H. pseudostrearia, and if it were not for the contradictory results of molecular barcoding, it could have been assigned to this species.

In this article, we describe the new species Haslea berepwari sp. nov. This description is based on LM and scanning electron microscopy (SEM) observations combined with two multigene phylogenies derived from the sequencing of the mitochondrial and plastid genome of this new species. The interest of New Caledonia as a hotspot for the discovery of new diatom species, as illustrated by this article, will be also discussed.

Material and methods

Sampling site, isolation and culture condition

Samplings were done in August 2020 in shrimp earthen ponds use for the co-breeding of Penaeus stylirostris Stimpson, 1871 and Holothuria scabra Jaeger, 1833 at the experimental aquaculture station of Saint Vincent (Boulouparis), located on the west coast of Grande Terre (coordinates: 21°55'36.9"S, 166°05'00.9"E, sampling authorization 15569-2019/4-ISP-DENV) (Fig. 1). Monoclonal cultures were obtained by single cell isolations performed with micropipettes under an inverted microscope (Zeiss, Primovert). Subsequently, it was carefully rinsed in several drops of site-filtered seawater (0.2 µm). The isolated strain was then transferred to cell culture multidishes filled with filtered (0.2 µm), autoclaved, and ES1/3-enriched seawater (Lebeau et al. 1999). The isolates were then cultured in a thermo-controlled incubator at a temperature of 24 °C, with an illumination of 50 µmol photons m-2 s-1. Finally, the isolates were transferred to 150 mL Erlenmeyer flasks containing 50 mL of ES1/3 medium and maintained under similar conditions in our culture collection. The strain was registered in the collections of Ifremer as P05.

Figure 1. 

Sampling location of Haslea berepwari in the experimental aquaculture station of Saint Vincent (21°55'36.9"S, 166°05'00.9"E), the West Coast of Grande Terre, New Caledonia, during summer 2020. Sampling point is indicated with the red dots sign. Map produced with QGIS software version 3.43.3 (QGIS.org 2023).

Microscopic observations

Live LM images were obtained using a Leica microscope (DM750, Leica Microsystems) equipped with ICC50 camera. The morphometry analysis was conducted using the Image J software (Schneider et al. 2012). All LM pictures were taken within two weeks after isolation, isolation and come as close as possible to wild or natural material.

For cleaned LM and SEM observations, cells were subsequently rinsed in two consecutive baths of milliQ water and left to oxidize overnight in H2O2. The following day, a drop of the sample was deposited on a glass cover slide, air-dried, and placed in a furnace (2 hours at 450 °C) for complete removal of organic matter. Pictures were taken with the same Leica DM750 microscope mentioned above.

For scanning electron microscopy (SEM) observations, cleaned samples were coated with an 8 nm layer of platinum (LEICA, EM ACE 600) and imaged using an environmental SEM equipped with a secondary electron detector (JSM-IT300 LV, 20 kV, 15 mm working distance, JEOL) at the University of New Caledonia.

DNA extraction and preliminary molecular barcoding

A culture of H. berepwari sp. nov. was maintained in exponential growth phase by frequent dilutions with fresh medium. A volume of 10 mL was harvested by centrifugation at 4500g and 5 °C during 10 min (Firlabo, SW9R, Meyzieu, France). Pellets of cells were then stored at -20 °C until analysis. The PowerSoil® DNA Isolation Kit was then used to extract the DNA and lyse the frustules. The DNA amplification and sequencing protocols were adapted from Gastineau et al. (2016). In brief, PCR reactions were conducted in a final volume of 20 μl using hot-start Taq polymerase (1X) (Qiagen) with its buffer: 10X PCR buffer (Qiagen), 200 μM of a dNTPs mix (Promega). Two sets of primers were employed: one targeting the 18S rRNA gene (18SHASLEAF: 5’_CTGCCCTATCAGCTTTGGATGG_3’, 18SHASLEAR: 5’_CCATTCAATCGGTAGGTGCG_3’) and the rbcl gene (RBCLF: 5’_GTCTCAATCTGTATCAGAACGG_3’, RBCLR: 5’_CGGTTAGCTGTTGGTGTTTCAGCG_3’) at a final concentration of 0.2 µM for each primer. All amplifications were performed in a VeritiTM thermocycler (Applied Biosystems, USA) for 35 cycles, as follows: 1 min denaturation at 95 °C, 1 min annealing at 60 °C for the 18S rRNA gene and 59 °C for the rbcL gene, 1 min 30 s elongation at 72 °C, followed by a final elongation step at 72 °C for 7 min. The size of all amplicons was verified using agarose gel electrophoresis. The PCR products that matched the expected size (around 1300 bp for the 18S rRNA gene and 1400 bp for the rbcL gene) were sent to GenoScreen (Lille, France) for Sanger sequencing. The raw sequence chromatograms were checked using Geneious Prime software and the reverse and forward sequences were combined. The consensus sequences were pairwise aligned using MEGA 11 (Tamura et al. 2021) and compared with sequences of Haslea spp. obtained from GenBank, which suggested that the species was different from these references. Consensus sequences are available as supplementary files as explained below.

Next generation sequencing, assembly and annotation

The pool of DNA that remained from the PCR and Sanger protocol described above was sent to the Beijing Genomics Institute (BGI, Shenzhen, China) to be sequenced on a DNBSEQ platform for a total of ca. 100M clean 150 bp paired-end reads. Reads were assembled using SPAdes 4 (Bankevich et al. 2012) with a k-mer of 125. The different subunits of the plastome were joined using Consed (Gordon and Green 2013). Genes were identified and annotated as explained in Gastineau et al. (2021a). The maps of the mitochondrial and plastid genomes were drawn on the OGDRAW online portal (Lohse et al. 2013).

Multigene phylogeny

Two phylogenies were performed. The first one was based on the available plastid genomes. Protein-coding genes were extracted from the plastomes of H. berepwari sp. nov. and 17 other species of Naviculaceae downloaded from GenBank plus Eunotia naegelii Migula 1905 to be used as an outgroup. Genes that were not shared by all the selected taxa or were likely pseudogenes were removed from the dataset, leading to a total of 123 conserved genes, which were all independently aligned by MAFFT 7 (Katoh and Standley 2013) with the -auto option, then trimmed with trimAl (Capella-Gutiérrez et al. 2009) and the -automated1 option before being concatenated by Phyutility 2.7.1 (Smith and Dunn 2008). The best model of evolution was verified on the concatenated alignment using ModelTest-NG (Darriba et al. 2020), which returned the GTR+I+G as best model with the three modes (BIC, AIC and AICc). The maximum likelihood phylogeny was performed using IQ-TREE 2.2.0 (Minh et al. 2020) with 1000 ultrafast bootstrap replicates. The second multigene phylogeny was performed by appending recently published datasets (Yılmaz et al. 2024a, 2024b) with sequences from H. berepwari and other Haslea spp. The dataset contains three genes, namely psbC, rbcL and 18S. The phylogeny was conducted using the same software as above, but the best model of evolution was evaluated on each gene alignment separately prior to concatenation, and was chosen based on the BIC mode. The model chosen were GTR+I+G4 (psbC), TIM3+I+G4 (rbcL) and TrN+I+G4 (18S). The dataset was partitioned based on these models, with 1000 ultrafast boostrap replicates. The dataset, partition file and complete tree are available as described in the data availability statement.

Results

Taxonomy

Haslea berepwari Mouget, Gastineau & Jauffrais, sp. nov.

Type material.

Holotype : The strain P05 was acid cleaned and mounted on a glass slide and is deposited in the herbarium “Paris Cryptogamie” (PC) at The French National Museum of Natural History under accession number PC0643624 (LM slide) and PC0643625 (SEM slide). The cell representative of the type is presented in Fig. 2.

Figure 2. 

Haslea berepwari sp. nov. in vivo pictures with two parietal chloroplasts and apices without the presence blue pigment in light microscopy (A, B) and LM image of a cleaned valve (C–E), scale bar 20µm.

Isotypes : SEM and LM slides with acid cleaned valves of strain P05 are kept at the Ifremer culture collection in New Caledonia under the accession number P05.

Type locality.

Boulouparis, New Caledonia. Haslea berepwari was isolated from shrimp earthen ponds (coordinates: 21°55'36.9"S, 166°05'00.9"E, Fig. 1) by Thierry Jauffrais in August 2020 in Boulouparis during a co-culture experiment of Penaeus stylirostris and Holothuria scabra.

Etymology.

The species designation is derived from the term “Boulouparis”, which is the one of the main cities on the west coast of New Caledonia. The name “Berepwari” is the translation of Boulouparis in xârâcùù, one of the main Melanesian languages spoken in New Caledonia.

Description.

LM Living cells solitary, motile and lanceolate, equipped with two parietal, narrow band-like chloroplasts appressed to the girdle of the cell (Fig. 2). Valves narrow and lanceolate with acute apices. The maximum and minimum length of the monoclonal culture of H. berepwari was 101.0 μm and 95.4 μm, respectively (average 98.0 ± 1.5 μm, n = 30), while the maximum and minimum width was 15.0 μm and 9.7 μm (average 12.2 ± 1.1 μm, n = 30). On clean frustules, raphe straight with non-distinct central endings. Cell wall exceedingly delicate, with longitudinal and transapical striations not discernible under LM. In general, LM provides minimal visibility into the specifics of the valve characteristics and is not sufficient to distinguish between this species and H. pseudostrearia.

SEM In external valve view, the exterior is covered with long, continuous, and apical-oriented siliceous stripes (top layer), proximal raphe endings straight and slightly widened, slightly deflected dorsally, apical raphe endings ventrally hook shaped (Fig. 3A, D). The interior is composed of a grate-like layer of small areolae, separated by short bars arranged crosswise. Transverse bars of this layer are almost equal in the transapical and longitudinal bars. The areolae are occluded externally by hymens and remnants of this membrane are visible in Fig. 3D. The central area lacks a lateral extension (Fig. 3A, D). Internally, the raphe is slightly elevated and straight, with well-developed helictoglossae at the poles (Fig. 3E). Internal openings of the raphe fissures directed towards one side of the raphe sternum, except at the center and near the tips. Thin bar near the central ending of the raphe on one side of the valve only (Fig. 3C). A supplementary ridge runs alongside the raphe sternum across most of the valve. Internally, square-shaped areolae organized in orderly rows (Fig. 3B, C, E). Externally, the valve seems covered with longitudinal bands, separated by slits running parallel to the raphe and converging into a single peripheral slit near the tips (Fig. 3A, F). The striation displays a transapical pattern of 37–38 striae per 10 µm intersected by a longitudinal pattern of 36 striae per 10 µm.

Figure 3. 

SEM micrographs of Haslea berepwari sp. nov. strain P05. A Whole valve in external view B whole valve in internal view C internal view of the center of the valve demonstrating accessory ribs and the presence of a thin bar on the left side of the raphe D external view of the valve centre showing approximate raphe endings and continuous longitudinal fissures E internal view of apex with the helictoglossa F external view of apex showing the curved distal raphe fissure and part of the parallel and longitudinal slits adjoining the peripheral one. Scale bars: 10 μm (A); 20 μm (B); 1 μm (C–F).

Differential diagnosis.

A comparative analysis of morphological features between H. berepwari, Haslea nusantara (Mouget, Gastineau and Syakti) and H. pseudostrearia is detailed in Table 1. Haslea berepwari sp. nov. shares strong similarities with H. pseudostrearia but is distinguished from it by the density of striae, both transapical and longitudinal.

Table 1.
Download as
CSV
XLSX

Comparison between H. berepwari, the similar species H. pseudostrearia and the tropical species.

Features H. nusantara H. pseudostrearia H. pseudostrearia H. berepwari
Length (μm) 73.9 ± 1.7 55.5 ± 0.2 37–43 98.0 ± 1.5
Width (μm) 6.8 ± 0.1 8.8 ± 0.1 6–7 12.2 ± 1.1
Transapical striae in 10 μm 36.0 ± 1.0 38.6 ± 0.2 34–36 36
Longitudinal striae in 10 μm 52.0 ± 2.0 42.8 ± 0.2 42 37–38
Pseudostauros Not present Not present Not present Not present
Axial costa Present Present Present Present
Central bar Present Present Present Present
Central raphe endings Straight Straight Straight Straight
Polar raphe endings Straight Deflected Deflected Deflected
Presence of blue pigment Yes No No No
References Prasetiya et al. (2019b) Prasetiya et al. (2019b) Massé et al. (2001) in this study

Genomics and phylogeny.

The nuclear rRNA gene cluster : For reasons unknown, we failed to assemble the complete cluster of nuclear rRNA, even after adjusting the k-mer parameter for assembly. However, we successfully retrieved the complete 18S gene and submitted it to GenBank (PP725422). This sequence completely validated the results obtained previously from Sanger sequencing. The sequence was aligned using Clustal Omega (Sievers et al. 2011) with references ascribed to H. pseudostrearia (AY485524 and KY320350) and identity was respectively 95.12% and 95.30%, while these two references were 99.81% identical with each other.

Mitochondrial genome : The mitochondrial genome of H. berepwari was retrieved from the contigs file with redundant endings. After trimming and circularization (Fig. 4), its length is 36,572 bp (GenBank: PP728232). The mitogenome encodes for 34 proteins, considering that nad11 is split into two distinct subunits. As it was noticed with other species of Haslea spp., nad6 and nad2 are merged into a single open reading frame (ORF), for a total size of 753 amino acids (Gastineau et al. 2021b; Dąbek et al. 2022). The mitogenome also encodes for three ORFs. The first one, orf162, corresponds to the conserved ORF generally found mttB and rps11 (Pogoda et al. 2019; Dąbek et al. 2022). We note that our annotation software (Gagnon 2004) ascribed it to rpl10, a function suggested for this ORF in Pleurosigma sp. (QYJ09263) (Wang et al. 2022). However, in the absence of more evidence of the function of this gene, we will keep labelling it as orf162, nothing also that the size of the putative protein encoded is identical among all the species of Haslea spp. for whom a mitogenome is available. The two other ORF, namely orf171 and orf235, are interspersed between the two subunits of nad11 and cox3 and are similar to ORFs found in the same position among other species of Haslea spp. (Gastineau et al. 2021b; Dąbek et al. 2022). InterProScan queries returned no results for orf235. For orf171, four transmembrane domains, three cytoplasmic regions and two non-cytoplasmic domains were found. The mitogenome also encodes 22 tRNA and two ribosomal rRNA.

Figure 4. 

Mitochondrial genome of Haslea berepwari sp. nov. Coloured boxes represent genes, with colours denoting their categories as indicated in the bottom left legend. The inner grey ring shows variations in G+C content.

Plastid genome : The plastid genome is 131,897 bp long (GenBank: PP728231) and exhibits the usual quadripartite structure (Fig. 5). The LSC is 65,599 bp long and contains 74 protein-coding genes and 17 tRNA. The SSC is 48,934 bp long and contains 52 protein-coding genes, a single non-conserved ORF and seven tRNA. The inverted repeats are 8,682 bp long and contains two protein-coding genes, a non-conserved ORF (orf118), three rRNA genes and three tRNA. The noticeable differences when compared to H. pseudostrearia are the position of cplC (between psbA and ycf35) and the absence of overlap between ycf45 and the IRB.

Figure 5. 

Plastid genome of Haslea berepwari sp. nov. Coloured boxes represent genes, with colours denoting their categories as indicated in the bottom left legend. The inner grey ring shows variations in G+C content.

Multigene phylogeny : The 123-genes ML phylogeny led to a highly supported tree in which all nodes display maximum support (Fig. 6). For the genus Haslea, the tree distinguishes between a highly supported clade of marennine-like producing species and a second clade that contains H. berepwari sp. nov. and H. pseudostrearia. It is noteworthy that the genetic distance between both species is rather important when compared to the distance between ‘blue’ species. Other taxa registered as Haslea on GenBank are nested within Navicula spp., but their belonging to the genus Haslea has been invalidated in Li et al. (2017) and thus should be instead regarded as Navicula spp. It is to note that Seminavis robusta D.B.Danielidis & D.G.Mann 2002 appears inside the Navicula clade, a position already observed in the 3-genes ML phylogeny recently published in Yılmaz et al. (2024a). The three-genes ML phylogeny (Fig. 7) also associated H. berepwari to a clade formed by two strains ascribed to H. pseudostrearia with high support. Sister to this clade is Haslea arculata Lobban & Ashworth, 2020, a species found in the Island of Guam and which is characterized by the curved shape of its frustule (Lobban et al. 2020). This large clade is sister to the sigmoid species Haslea nipkowii (Meister) M.Poulin & G.Massé 2004 (Poulin et al. 2004) and Haslea feriarum M.A. Tiffany & F.A.S. Sterrenburg 2015, a species with dorsoventral valve shape (Sterrenburg et al. 2015; Li et al. 2017). The tree strictly separates ‘blue’ and ‘non-blue’ taxa.

Figure 6. 

Maximum Likelihood phylogenetic tree obtained from concatenated alignments of 123 protein coding genes from 19 species of diatoms. The tree is rooted with Eunotia naegelii.

Figure 7. 

Maximum Likelihood phylogenetic tree obtained from concatenated alignments of three protein coding genes from 133 species of diatoms. The tree was rooted with Triparma pacifica. The subtree containing the 14 species of Haslea spp. is shown.

Discussion

Comparison between H. berepwari and similar species

Morphologically as well as phylogenetically, H. berepwari is very similar to H. pseudostrearia. We can cite the shape of the external distal raphe ending, which is curved in both taxa. This characteristic is also present among other species such as, for example, Haslea salstonica Massé, Rincé & E.J.Cox 2000 or Haslea crucigera (W.Smith) Simonsen 1974 (Massé et al. 2001). However, it has never been observed among any of the ‘blue’ species so far, and for this reason, it can be regarded at least as a relevant criteria to discriminate between H. berepwari and the ‘blue’ species H. nusantara, for example. The presence of a central thin bar close to the internal proximal raphe ending is an interesting character too, but that could also be misleading. This thin bar is exhibited by H. berepwari and H. pseudostrearia, but also by the ‘blue’ species Haslea silbo Gastineau, Hansen & Mouget, 2021 and H. nusantara, while it is completely absent in H. ostrearia, H. karadagensis and Haslea provincialis Gastineau, Hansen & Mouget, 2016 (Gastineau et al. 2012a, 2016, 2021a; Prasetiya et al. 2019b). So far, the difference in the density of longitudinal striae between H. berepwari and H. pseudostrearia seems to be the most reliable morphological character to distinguish between both species.

Evidences for a ‘pseudostrearia-like’ clade among the genus Haslea

When they described H. pseudostrearia, Massé et al. (2001) noted its similarities to H. ostrearia, which influenced their choice of the name. At that time, their conclusions were based solely on morphology, as no molecular analyses were conducted. Later, the genetic proximity between these two species was assessed by the nuclear 18S-inferred phylogeny of Damsté et al. (2004) and, to some extent the plastidic 16S-inferred phylogeny of Poulin et al. (2004). However, two points need to be underlined. First, the sampling of properly identified Haslea spp. was of four taxa in Damsté et al. (2004). Poulin et al. (2004) identified six taxa at the species level plus one labelled as ‘Haslea sp.’. None of these studies included more than one single blue species, as it predates the description of Haslea karadagensis Davidovich, Gastineau & Mouget in 2012 (Gastineau et al. 2012a). It should be noted that in Poulin et al. (2004), with an increased sample of species, H. pseudostrearia clusters with the aforementioned Haslea sp. As a molecular marker, 16S has not been widely employed among diatoms, so comparisons were limited until complete plastid genomes had been published. Out of curiosity, the 16S gene of this Haslea sp. (AF514851) was submitted to a megablast query. It appears that after itself, the best result returned is H. berepwari (1324/1332 bp identical), before H. pseudostrearia SCCAP K-1594 (1321/1332 identical) or H. ostrearia (1320/1332 bp identical). There is limited information available regarding this Haslea sp., except that it originates from the Bay of Bourgneuf, France (Poulin et al. 2004). In the absence of further data on this strain, we can only hypothesize that there may be several species, worldwide and from very distinct environments, that could belong to a ‘pseudostrearia-like’ clade, warranting further investigation. The three-genes tree provides additional support to this hypothesis. Indeed, the two strains ascribed to H. pseudostrearia, although clustering together, are characterized by an important genetic distance between them, consequently larger than what can be observed between the two strains of H. silbo or the three strains of H. karadagensis and even more important than the distance separating H. ostrearia from H. provincialis. We hope that in the future, we will be able to investigate more ‘pseudostrearia-like’ taxa, with the same protocol as employed here.

Biodiversity of New Caledonian diatoms

The study of freshwater diatoms in New Caledonia can be traced back to the early 20th century (Pearson et al. 1922), at a time where the only available tool would be LM. With the development of SEM, the flora had been reinvestigated by Pr. René Le Cohu (1985), who, along with colleagues, continued to explorer the freshwater taxa (Le Cohu et al. 2018, 2020a, 2020b; Marquie et al. 2018). In contrast, research on marine diatoms has been more recent, relatively limited and was conducted by Dr. Catherine Riaux-Gobin and colleagues. Similar to the current article, their studies have highlighted the biodiversity of this region, sometimes leading to the description of new species and genera (Riaux-Gobin et al. 2022a, 2022b). New Caledonia also possess a coral reef, and such environments are known to host very diverse diatom assemblages (Risjani et al. 2021). For all these reasons, we might advocate for a more systematic investigation of New Caledonian diatom biodiversity. Such investigations should employ a protocol that integrates morphological and molecular (if not genomic) analyses. This approach would enhance our general knowledge on South Pacific diatoms and contribute to the development of accurate and reliable databases for coastal biomonitoring. Additionally, it is worth noting that this diatom was isolated from an aquaculture facility, and such facilities could also benefit from the bioprospection of local diatoms, for example, as feed sources for larval stages of artificially grown organisms

Acknowledgments

For the SEM images, this work has benefited from the facilities of P2M with the technical assistance of Aurélie Monnin and Olivia Barthelemy, Université de la Nouvelle Calédonie. The authors acknowledge the South Province of New Caledonia who delivered the sampling authorization (RECEP 15569-2019/4-ISP-DENV) for the GHANA/H2020-MSCA-RISE project in New Caledonia and Noémie Coulombier from the Adecal Technopole of New Caledonia for technical assistance.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This publication benefited from funding from the International research collaboration-scientific publication (Indonesia – France) ‘Séjour Scientifique d’Haut Niveau Programme 2022’ (SSHN 2022, granted to FSP) and the Science Impact Programme 2023–2024 (granted to FSP) from l’Institut Français d’Indonésie and the French Embassy in Indonesia. This work was co-financed by the Minister of Science under the “Regional Excellence Initiative” Program for 2024–2027 (RID/SP/0045/2024/01) and by the Horizon 2020 Research and Innovation Programme GHaNA (The Genus Haslea, New marine resources for blue biotechnology and Aquaculture) under Grant Agreement No 734708/GHANA/H2020-MSCA-RISE-2016 (granted to JLM). Claude Lemieux and Monique Turmel were supported by grant RGPIN-2017-04506 from the Natural Sciences and Engineering Research Council of Canada (NSERC).

Author contributions

Conceptualisation: FSP, TJ, RG. Funding acquisition: JLM. Investigation: FSP, MMB, TJ, NC, DA, EY, CL, MT, JLM, DAP, DCP, DRN, VF, SA, RG. Project administration: TJ, JLM. Supervision: TJ, RG. Writing – original draft: FSP, TJ, NC, RG. Writing – review and editing: MMB, DA, EY, CL, MT, JLM, DAP, DCP, DRN, VF, SA.

Author ORCIDs

Fiddy Semba Prasetiya https://orcid.org/0000-0001-6474-2319

Thierry Jauffrais https://orcid.org/0000-0001-9681-6239

Mustapha Mohamed-Benkada https://orcid.org/0000-0003-1865-3854

Nolwenn Callac https://orcid.org/0000-0002-7578-3455

Elif Yılmaz https://orcid.org/0000-0001-7939-1814

Claude Lemieux https://orcid.org/0000-0001-9580-8042

Monique Turmel https://orcid.org/0000-0001-7060-035X

Jean-Luc Mouget https://orcid.org/0000-0003-0154-7289

Danang Ambar Prabowo https://orcid.org/0000-0001-8200-1266

Debora Christin Purbani https://orcid.org/0000-0001-9305-2835

Diah Radini Noerdjito https://orcid.org/0000-0002-3274-7307

Varian Fahmi https://orcid.org/0000-0002-4273-9087

Sulastri Arsad https://orcid.org/0000-0002-7322-7834

Romain Gastineau https://orcid.org/0000-0001-8661-5118

Data availability

All of the data that support the findings of this study are available in the main text. All the sequences derived from next generation sequencing are available on GenBank with accession numbers PP725422, PP728232 and PP728231. Sequencing reads have been deposited on the Sequence Read Archive (SRA) with accession number SRR31857227, BioProject PRJNA1199224 and BioSample SAMN45869835. Original LM and SEM pictures plus the sequences obtained by PCR and Sanger sequencing are available on Zenodo following this link: https://doi.org/10.5281/zenodo.14506379. The dataset for the three-genes phylogeny, the partition file used and the complete tree obtained are all available following this link: https://doi.org/10.5281/zenodo.14931226.

References

  • Adjout R, Mouget JL, Pruvost J, Chentir I, Loiseau C, Baba Hamed MB (2022) Effects of temperature, irradiance, and pH on the growth and biochemical composition of Haslea ostrearia batch-cultured in an airlift plan-photobioreactor. Applied Microbiology and Biotechnology 106(13–16): 5233–5247. https://doi.org/10.1007/s00253-022-12055-1
  • An SM, Choi DH, Lee JH, Lee H, Noh JH (2017) Identification of benthic diatoms isolated from the eastern tidal flats of the Yellow Sea: Comparison between morphological and molecular approaches. PLoS One 12(6): e0179422. https://doi.org/10.1371/journal.pone.0179422
  • Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov A, Lesin VM, Nikolenko SI, Pham S, Prjibelski A, Pyshkin AV, Sirotkin AV, Vyahhi N, Tesler G, Alekseyev MA, Pevzner PA (2012) SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. Journal of Computational Biology 19: 455–477. https://doi.org/10.1089/cmb.2012.0021
  • Bell JD, Agudo NN, Purcell SW, Blazer P, Simutoga M, Pham D, Della Patrona L (2007) Grow-out of sandfish Holothuria scabra in ponds shows that co-culture with shrimp Litopenaeus stylirostris is not viable. Aquaculture (Amsterdam, Netherlands) 273(4): 509–519. https://doi.org/10.1016/j.aquaculture.2007.07.015
  • Callac N, Boulo V, Giraud C, Beauvais M, Ansquer D, Ballan V, Maillez JR, Wabete N, Pham D (2022) Microbiota of the rearing water of Penaeus stylirostris larvae influenced by lagoon seawater and specific key microbial lineages of larval stage and survival. Microbiology Spectrum 10(6): e0424122. https://doi.org/10.1128/spectrum.04241-22
  • Callac N, Giraud C, Boulo V, Wabete N, Pham D (2023) Microbial biomarker detection in shrimp larvae rearing water as putative bio-surveillance proxies in shrimp aquaculture. PeerJ 11: e15201. https://doi.org/10.7717/peerj.15201
  • Callac N, Giraud C, Pham D, Ansquer D, Wabete N, Boulo V (2024) Active microbiota of Penaeus stylirostris larvae: Partially shaped via vertical and horizontal transmissions and larval ontogeny. Microorganisms 12(3): 608. https://doi.org/10.3390/microorganisms12030608
  • Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T (2009) trimAl: A tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics (Oxford, England) 25(15): 1972–1973. https://doi.org/10.1093/bioinformatics/btp348
  • Colette M, Guentas L, Gunkel-Grillon P, Callac N, Della Patrona L (2022) Is halophyte species growing in the vicinity of the shrimp ponds a promising agri-aquaculture system for shrimp ponds remediation in New Caledonia? Marine Pollution Bulletin 177: 113563. https://doi.org/10.1016/j.marpolbul.2022.113563
  • Colette M, Guentas L, Della Patrona L, Ansquer D, Callac N (2023) Suaeda australis and its associated rhizosphere microbiota: A comparison of the nutrient removal potential between different shrimp farm sediments in New Caledonia. Frontiers in Microbiology 14: 1260585. https://doi.org/10.3389/fmicb.2023.1260585
  • Dąbek P, Gastineau R, Bornman TG, Lemieux C, Turmel M, Hallegraeff G, Mouget J-L, Witkowski A (2022) The blue diatom Haslea ostrearia from the Indian Ocean coast of South Africa, with comparative analysis of Haslea organellar genomes. Frontiers in Marine Science 9: 950716. https://doi.org/10.3389/fmars.2022.950716
  • Damsté JS, Muyzer G, Abbas B, Rampen SW, Massé G, Allard WG, Belt ST, Robert JM, Rowland SJ, Moldowan JM, Barbanti SM, Fago FJ, Denisevich P, Dahl J, Trindade LA, Schouten S (2004) The rise of the rhizosolenid diatoms. Science 304(5670): 584–587. https://doi.org/10.1126/science.1096806
  • Darriba D, Posada D, Kozlov AM, Stamatakis A, Morel B, Flouri T (2020) ModelTest-NG: A new and scalable tool for the selection of DNA and protein evolutionary models. Molecular Biology and Evolution 37(1): 291–294. https://doi.org/10.1093/molbev/msz189
  • Falaise C, James A, Travers MA, Zanella M, Badawi M, Mouget JL (2019a) Complex relationships between the Blue Pigment Marennine and Marine Bacteria of the genus Vibrio. Marine Drugs 17(3): 160. https://doi.org/10.3390/md17030160
  • Falaise C, Cormier P, Tremblay R, Audet C, Deschênes JS, Turcotte F, François C, Seger A, Hallgraeff G, Lindquist N, Sirjacobs D, Gobert S, Lejeune P, Demoulin V, Mouget JL (2019b) Harmful or harmless: Biological effects of marennine on marine organisms. Aquatic Toxicology (Amsterdam, Netherlands) 209: 13–25. https://doi.org/10.1016/j.aquatox.2019.01.016
  • Gaillon B (1820) Des huîtres vertes, et des causes de cette coloration. Journal de Physique, de Chimie, d’Histoire Naturelle et des Arts 91, 222–225.
  • Gargouch N, Touchard R, Marec H, Mouget JL, Pruvost J, Massé A (2022) Submerged membrane photobioreactor for the cultivation of Haslea ostrearia and the continuous extraction of extracellular marennine. Bioresource Technology 350: 126922. https://doi.org/10.1016/j.biortech.2022.126922
  • Gastineau R, Davidovich NA, Bardeau JF, Caruso A, Leignel V, Hardivillier Y, Jacquette B, Davidovich OI, Rince Y, Gaudin P, Cox EJ, Mouget JL (2012a) Haslea karadagensis (Bacillariophyta): A second blue diatom, recorded from the Black Sea and producing a novel blue pigment. European Journal of Phycology 47: 469–479. https://doi.org/10.1080/09670262.2012.741713
  • Gastineau R, Hardivillier Y, Leignel V, Tekaya N, Morançais M, Fleurence J, Davidovich N, Jacquette B, Gaudin P, Hellio C, Bourgougnon N, Mouget JL (2012b) Greening effect on oysters and biological activities of the blue pigments produced by the diatom Haslea karadagensis (Naviculaceae). Aquaculture (Amsterdam, Netherlands) 368–369: 61–67. https://doi.org/10.1016/j.aquaculture.2012.09.016
  • Gastineau R, Turcotte F, Pouvreau J-B, Morançais M, Fleurence J, Windarto E, Prasetiya FS, Arsad S, Jaouen P, Babin M, Coiffard L, Couteau C, Bardeau JF, Jacquette B, Leignel V, Hardivillier Y, Marcotte I, Bourgougnon N, Tremblay R, Deschênes JS, Badawy H, Pasetto P, Davidovich N, Hansen G, Dittmer J, Mouget JL (2014) Marennine, promising blue pigments from a widespread Haslea diatom species complex. Marine Drugs 12: 3161–3189. https://doi.org/10.3390/md12063161
  • Gastineau R, Hansen G, Davidovich NA, Davidovich O, Bardeau J-F, Kaczmarska I, Ehrman JM, Leignel V, Hardivillier Y, Jacquette B, Poulin M, Morançais M, Fleurence J, Mouget J-L (2016) A new blue-pigmented hasleoid diatom, Haslea provincialis, from the Mediterranean Sea. European Journal of Phycology 51: 156–170. https://doi.org/10.1080/09670262.2015.1110861
  • Gastineau R, Hamedi C, Baba Hamed MB, Abi-Ayad S-ME-A, Bąk M, Lemieux C, Turmel M, Dobosz S, Wróbel RJ, Kierzek A, Lange-Bertalot H, Witkowski A (2021a) Morphological and molecular identification reveals that waters from an isolated oasis in Tamanrasset (extreme South of Algerian Sahara) are colonized by opportunistic and pollution-tolerant diatom species. Ecological Indicators 121(6): 107104. https://doi.org/10.1016/j.ecolind.2020.107104
  • Gastineau R, Hansen G, Poulin M, Lemieux C, Turmel M, Bardeau JF, Leignel V, Hardivillier Y, Morançais M, Fleurence J, Gaudin P, Méléder V, Cox EJ, Davidovich NA, Davidovich OI, Witkowski A, Kaczmarska I, Ehrman JM, Soler Onís E, Quintana AM, Mucko M, Mordret S, Sarno D, Jacquette B, Falaise C, Séveno J, Lindquist NL, Kemp Jr PS, Eker-Develi E, Konucu M, Mouget JL (2021b) Haslea silbo, a novel cosmopolitan species of blue diatoms. Biology (Basel) 10: 328. https://doi.org/10.3390/biology10040328
  • Giraud C, Callac N, Beauvais M, Mailliez J, Ansquer D, Selmaoui-Folcher N, Pham D, Wabete N, Boulo V (2021) Potential lineage transmission within the active microbiota of the eggs and the nauplii of the shrimp Litopenaeus stylirostris: Possible influence of the rearing water and more. PeerJ 9: e12241. https://doi.org/10.7717/peerj.12241
  • Giraud C, Callac N, Boulo V, Lam JS, Pham D, Selmaoui-Folcher N, Wabete N (2022) The active microbiota of the eggs and the Nauplii of the Pacific Blue Shrimp Litopenaeus stylirostris partially shaped by a potential vertical transmission. Frontiers in Microbiology 13: 886752. https://doi.org/10.3389/fmicb.2022.886752
  • Guiry MD, Guiry GM 21 (2011) AlgaeBase. World-wide electronic publication, National University of Ireland, Galway. https://www.algaebase.org [searched on 18 March 2025]
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010
  • Le Cohu R, Marquié J, Tudesque L (2018) Three new species of Delicata (Bacillariophyceae – Cymbellales) from New Caledonia and further observations on Delicata nepouiana Krammer and D. neocaledonica Krammer. Diatom Research 33(1): 39–53. https://doi.org/10.1080/0269249X.2017.1407827
  • Le Cohu R, Lange-Bertalot H, Van de Viver B, Tudesque L (2020a) Analysis and critical evaluation of structural features in four Cymbellaceae taxa from New Caledonia. Fottea 20(1): 75–85. https://doi.org/10.5507/fot.2019.017
  • Lemonnier H, Wabete N, Pham D, Lignot J-H, Barri K, Mermoud I, Royer F, Boulo V, Laugier T (2021) Iron deposits turn blue shrimp gills to orange. Aquaculture (Amsterdam, Netherlands) 540: 736697. https://doi.org/10.1016/j.aquaculture.2021.736697
  • Li Y, Chen X, Sun Z, Xu K (2017) Taxonomy and molecular phylogeny of three marine benthic species of Haslea (Bacillariophyceae), with transfer of two species to Navicula. Diatom Research 8347: 1–13. https://doi.org/10.1080/0269249X.2017.1401008
  • Lobban CS, Perez CO, Ashworth MP (2020) Non-blue Haslea species (Bacillariophyceae: Naviculaceae) in the benthic marine flora of Guam (Mariana Islands, Western Pacific Ocean). Diatom Research 35(2): 163–183. https://doi.org/10.1080/0269249X.2020.1761887
  • Lohse M, Drechsel O, Kahlau S, Bock R (2013) OrganellarGenomeDRAW—a suite of tools for generating physical maps of plastid and mitochondrial genomes and visualizing expression data sets. Nucleic acids research 41(Web Server issue): W575–W581. https://doi.org/10.1093/nar/gkt289
  • Marquie J, Le Cohu R, Coste M (2018) Adlafia moseri and A. tjibaoui two new diatom species (Bacillariophyta) from New Caledonia with further observations on Adlafia muscora and Kobayasiella saxicola. Phytotaxa 357(1): 41–51. https://doi.org/10.11646/phytotaxa.357.1.4
  • Massé G, Rincé Y, Cox EJ, Allard G, Belt ST, Rowland SJ (2001) Haslea salstonica sp. nov. and Haslea pseudostrearia sp. nov. (Bacillariophyta), two new epibenthic diatoms from the Kingsbridge estuary, United Kingdom. Comptes Rendus de l’Académie des Sciences. Série III, Sciences de la Vie 324: 617–626. https://doi.org/10.1016/S0764-4469(01)01330-0
  • Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, Lanfear R (2020) IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Molecular Biology and Evolution 37(5): 1530–1534. https://doi.org/10.1093/molbev/msaa015
  • Nghiem Xuan R, Mouget JL, Turpin V, Jaouen P, Pruvost J (2021) Optimization of the growth and marennine production by the diatom Haslea ostrearia in photobioreactor. Algal Research-Biomass Biofuels and Bioproducts 55: 102251. https://doi.org/10.1016/j.algal.2021.102251
  • Nguyen NTB, Wantiez L, Lemaire P, Chim L (2022) Feed efficiency, tissue growth and energy budget changes during the molting cycle of Juvenile Mud Crab, Scylla serrata: Effects of dietary proteins, fishmeal versus soy protein concentrate. Fishes 7(6): 334. https://doi.org/10.3390/fishes7060334
  • Pearson WH, Gepp A, Carter N, Groves J, Smith AL, Wakefield EM, Lister G (1922) A systematic account of the plants collected in New Caledonia and the Isle of Pines by Mr. R. H. Compton, M.A., in 1914.-Part III. Cryptogams (Hepaticae-Fungi). Journal of the Linnean Society of London, Botany 46(305): 13–96. https://doi.org/10.1111/j.1095-8339.1922.tb00474.x
  • Permatasari I, Prasetiya F, Arsad S, Agung M, Mouget JL (2019) Antibacterial activity of Haslea ostrearia supernatant adapted in Indonesia against pathogenic bacteria relevant to mariculture (in-vitro study). Omni-Akuatika 15(1): 30–38. https://doi.org/10.20884/1.oa.2019.15.1.626
  • Pogoda CS, Keepers KG, Hamsher SE, Stepanek JG, Kane NC, Kociolek JP (2019) Comparative analysis of the mitochondrial genomes of six newly sequenced diatoms reveals group II introns in the barcoding region of cox1. Mitochondrial DNA. Part A, DNA Mapping, Sequencing, and Analysis 30: 43–51. https://doi.org/10.1080/24701394.2018.1450397
  • Poulin M, Massé G, Belt ST, Delavault P, Rousseau F, Robert JM, Rowland SJ (2004) Morphological, biochemical and molecular evidence for the transfer of Gyrosigma nipkowii Meister to the genus Haslea (Bacillariophyta). European Journal of Phycology 39: 181–195. https://doi.org/10.1080/0967026042000202136
  • Pouvreau J, Housson E, Tallec LL, Morançais M, Rincé Y, Fleurence J, Pondaven P (2007) Growth inhibition of several marine diatom species induced by the shading effect and allelopathic activity of marennine, a blue-green polyphenolic pigment of the diatom Haslea ostrearia (Gaillon/Bory) Simonsen. Journal of Experimental Marine Biology and Ecology 352: 212–225. https://doi.org/10.1016/j.jembe.2007.07.011
  • Pouvreau JB, Morançais M, Taran F, Rosa P, Dufossé L, Guérard F, Pin S, Fleurence J, Pondaven P (2008) Antioxidant and free radical scavenging properties of marennine, a blue-green polyphenolic pigment from the diatom Haslea ostrearia (Gaillon/Bory) Simonsen responsible for the natural greening of cultured oysters. Journal of Agricultural and Food Chemistry 56(15): 6278–6286. https://doi.org/10.1021/jf073187n
  • Prasetiya FS, Safitri I, Widowati I, Cognie B, Decottignies P, Gastineau R, Morançais M, Windarto E, Tremblay R, Mouget JL (2016) Does allelopathy affect co-culturing Haslea ostrearia with other microalgae relevant to aquaculture? Journal of Applied Phycology 1–14. https://doi.org/10.1007/s10811-015-0779-y
  • Prasetiya FS, Comeau L, Gastineau R, Decottignies P, Cognie B, Morançais M, Turcotte F, Mouget JL, Tremblay R (2017a) Effect of marennine produced by the blue diatom Haslea ostrearia on behavioral, physiological and biochemical traits of juvenile Mytilus edulis and Crassostrea virginica. Aquaculture (Amsterdam, Netherlands) 467: 138–148. https://doi.org/10.1016/j.aquaculture.2016.08.029
  • Prasetiya FS, Decottignies P, Barillé L, Gastineau R, Jacquette B, Figiel A, Morançais M, Tremblay R, Mouget JL, Cognie B (2017b) Cell size-based, passive selection of the blue diatom Haslea ostrearia by the oyster Crassostrea gigas. The Journal of Molluscan Studies 83: 145–152. https://doi.org/10.1093/mollus/eyx012
  • Prasetiya FS, Decottignies P, Tremblay R, Mouget JL, Cognie B (2019a) Does culture supernatant of Haslea ostrearia containing marennine a ff ect short-term physiological traits in the adult blue mussel Mytilus edulis? Aquaculture Reports 15: 100228–100228. https://doi.org/10.1016/j.aqrep.2019.100228
  • Prasetiya FS, Gastineau R, Poulin M, Lemieux C, Turmel M, Syakti AD, Hardivillier Y, Widowati I, Risjani Y, Iskandar I, Subroto T, Falaise C, Arsad S, Safitri I, Mouget JL, Leignel V (2019b) Haslea nusantara (Bacillariophyceae), a new blue diatom from the Java Sea, Indonesia: Morphology, biometry and molecular characterization. Plant Ecology and Evolution 152: 188–202. https://doi.org/10.5091/plecevo.2019.1623
  • Prasetiya FS, Decottignies P, Tremblay R, Mouget JL, Sunarto S, Iskandar I, Dhahiyat Y, Cognie B (2020a) Not only greening: The effects of marennine produced by Haslea ostrearia on physiological traits of three bivalve species. Aquaculture Reports 18: 100546–100546. https://doi.org/10.1016/j.aqrep.2020.100546
  • Prasetiya FS, Sunarto S, Bachtiar E, Agung MUK, Nathanael B, Pambudi AC, Lestari AD, Astuty S, Mouget JL (2020b) Effect of the blue pigment produced by the tropical diatom Haslea nusantara on marine organisms from different trophic levels and its bioactivity. Aquaculture Reports 17: 100389–100389. https://doi.org/10.1016/j.aqrep.2020.100389
  • Prasetiya FS, Arsad S, Astuty S, Mochamad U, Agung K, Stavrakakis C, Mouget JL (2021a) Effect of culture supernatant from Haslea ostrearia on the clearance rate and survival rate of adult Pacific oyster Crassostrea gigas infected with Vibrio aestuarianus. Aquaculture, Aquarium, Conservation & Legislation 14: 2050–2060. http://www.bioflux.com.ro/docs/2021.2050-2060.pdf
  • Prasetiya FS, Ramdhani DS, Mulyani Y, Mochamad U, Agung K, Arsad S, Mouget JL (2021b) Antioxidant activities of culture supernatant Haslea ostrearia adapted in Indonesia. Aquaculture, Aquarium, Conservation & Legislation 14: 111–119. http://bioflux.com.ro/docs/2021.111-119.pdf
  • Prasetiya FS, Foret M, Deschênes JS, Gastineau R, Mouget JL, Tremblay R (2022) Semi-continuous system for benthic diatom cultivation and marennine production. Algal Research 62: 102633. https://doi.org/10.1016/j.algal.2022.102633
  • Purcell SW, Patrois J, Fraisse N (2006) Experimental evaluation of co-culture of juvenile sea cucumbers, Holothuria scabra (Jaeger), with juvenile blue shrimp, Litopenaeus stylirostris (Stimpson). Aquaculture Research 37: 515–522. https://doi.org/10.1111/j.1365-2109.2006.01458.x
  • Riaux-Gobin C, Witkowski A, Coste M, Berteaux-Lecellier V, Daniszewska-Kowalczyk G (2022a) Marine Achnanthales (Bacillariophyceae) from New Caledonia (Melanesia): Assemblage specificities, ultramafic environment. Phytotaxa 552(1): 1–21. https://doi.org/10.11646/phytotaxa.552.1.1
  • Riaux-Gobin C, Witkowski A, Risjani Y, Yunianta Y, Berteaux-Lecellier V, Peszek Ł, Daniszewska-Kowalczyk G (2022b) Upsilococconeis dapalistriata gen. nov. & comb. nov. (Bacillariophyta) – a pantropical marine member of Cocconeidaceae. Oceanological and Hydrobiological Studies 51(1): 23–31. https://doi.org/10.26881/oahs-2022.1.03
  • Risjani Y, Witkowski A, Kryk A, Yunianta , Górecka E, Krzywda M, Safitri I, Sapar A, Dąbek P, Arsad S, Gusev E, Rudiyansyah , Peszek Ł, Wróbel RJ (2021) Indonesian coral reef habitats reveal exceptionally high species richness and biodiversity of diatom assemblages. Estuarine, Coastal and Shelf Science 261: 107551. https://doi.org/10.1016/j.ecss.2021.107551
  • Seveno J, Witkowski A, Car A, Gastineau R, Sirjacobs D, Leignel V, Mouget JL (2024) Impact of blue Haslea spp. blooms on benthic diatom and bacterial communities. Phycology 4(3): 465–507. https://doi.org/10.3390/phycology4030027
  • Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Söding J, Thompson JD, Higgins DG (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Molecular Systems Biology 7: 539. https://doi.org/10.1038/msb.2011.75
  • Simonsen R (1974) The diatom plankton of the Indian Ocean Expedition of R/V Meteor 1964-5, “Meteor” Forschungsergebnisse. Reihe D: Biologie 19, 1–107.
  • Sterrenburg FAS, Tiffany MA, Hinz F, Herwig WE, Hargraves PE (2015) Seven new species expand the morphological spectrum of Haslea. A comparison with Gyrosigma and Pleurosigma (Bacillariophyta). Phytotaxa 207: 143–162. https://doi.org/10.11646/phytotaxa.207.2.1
  • Talgatti D, Sar EA, Torgan LC (2014) Haslea sigma (Naviculaceae, Bacillariophyta) a new sigmoid benthic species from salt marshes of Southern Brazil. Phytotaxa 177: 231–238. https://doi.org/10.11646/phytotaxa.177.4.4
  • Wang Y, Liu S, Wang J, Yao Y, Chen Y, Xu Q, Zhao Z, Chen N (2022) Diatom biodiversity and speciation revealed by comparative analysis of mitochondrial genomes. Frontiers in Plant Science 13: 749982. https://doi.org/10.3389/fpls.2022.749982
  • Yılmaz E, Mann DG, Gastineau R, Trobajo R, Solak CN, Górecka E, Turmel M, Lemieux C, Ertorun N, Witkowski A (2024a) Description of Navicula vanseea sp. nov. (Naviculales, Naviculaceae), a new species of diatom from the highly alkaline Lake Van (Republic of Türkiye) with complete characterisation of its organellar genomes and multigene phylogeny. PhytoKeys 241: 27–48. https://doi.org/10.3897/phytokeys.241.118903
  • Yılmaz E, Gastineau R, Solak CN, Górecka E, Trobajo R, Turmel M, Lemieux C, Otis C, Witkowski A, Mann DG (2024b) Morphological and molecular characterization of Halamphora vantushpaensis (Bacillariophyceae, Amphipleuraceae), a new diatom species widely dispersed on the shores of the soda Lake Van (Türkiye). PhytoKeys 249: 95–114. https://doi.org/10.3897/phytokeys.249.133205
login to comment