Research Article
Print
Research Article
Studies of Vietnamese Pteridophyte Flora 3
expand article infoCheng-Wei Chen‡§, Van Truong Do|, Quang Cuong Truong, Viet Dai Dang#, Hong Truong Luu#, Yi-Shan Chao§, Yao-Moan Huang¤, Kuo-Fang Chung‡
‡ Biodiversity Research Center, Academia Sinica, Taipei, Taiwan
§ National Taiwan Normal University, Taipei, Taiwan
| Vietnam Academy of Science and Technology, Hanoi, Vietnam
¶ International Center for Tropical Highlands Ecosystems Research of Bidoup - Nui Ba National Park, Lam Dong, Vietnam
# Vietnam Academy of Science and Technology, Ho Chi Minh City, Vietnam
¤ Taiwan Forestry Research Institute, Taipei, Taiwan

Corresponding author: Cheng-Wei Chen ( wade0504@gmail.com )

Corresponding author: Kuo-Fang Chung ( bochung@gate.sinica.edu.tw )

Academic editor: Joel Nitta
© 2025 Cheng-Wei Chen, Van Truong Do, Quang Cuong Truong, Viet Dai Dang, Hong Truong Luu, Yi-Shan Chao, Yao-Moan Huang, Kuo-Fang Chung.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Chen C-W, Do VT, Truong QC, Dang VD, Luu HT, Chao Y-S, Huang Y-M, Chung K-F (2025) Studies of Vietnamese Pteridophyte Flora 3. PhytoKeys 255: 143-169. https://doi.org/10.3897/phytokeys.255.141395
Open Access

Abstract

This is the third paper in a series dedicated to updating the knowledge of the Vietnamese pteridophyte flora. Based on recent collections, we first reported three new national records of ferns: Haplopteris yakushimensis, Lindsaea kohkongensis, and Pteris pseudowulaiensis. Secondly, we conducted phylogenetic analyses to investigate the placements of Lindsaea kohkongensis and Leptochilus poilanei, each based on three plastid DNA markers. Our results revealed that Lindsaea kohkongensis is sister to L. ensifolia, while Leptochilus poilanei is embedded within L. cantoniensis. We discussed these results in the context of systematics. Lastly, we reported chromosome numbers for 20 fern species in Vietnam. For seven of these species, including Gymnosphaera salletii, Lepisorus spicatus, Leptochilus poilanei, Pteridrys costularis, Pteris latipinna, Pyrrosia eberhardtii, and Tectaria setulosa, these counts were recorded for the first time. Additionally, three new cytotypes were identified for Diplazium doederleinii, Pteris esquirolii, and Tectaria harlandii. This study underscores the need for more diverse data, including DNA sequences, chromosome numbers, and reproductive modes, to be collected and integrated into systematic studies and taxonomic treatments to enhance our understanding of Vietnam’s pteridophyte flora.

Key words:

Chromosome number, cytology, Indochina, new records, phylogeny

Introduction

This marks the third paper in our series on Vietnam’s pterido-flora (Chen et al. 2021; 2023). This series of studies aims to provide updated knowledge of the country’s pteridophyte flora, based on recent expeditions as well as the studies of herbarium specimens and relevant literature. Here, we reported three new additions to Vietnam’s flora: Haplopteris yakushimensis C.W.Chen & Ebihara (Fig. 1), Lindsaea kohkongensis I.C.Hwang, M.O.Moon & B.Y.Sun (Fig. 2), and Pteris pseudowulaiensis Y.S.Chao (Fig. 3) based on our new collections.

Figure 1. 

Haplopteris yakushimensis C.W.Chen & Ebihara (Chen Wade6952) A habit B rhizome scales C adaxial lamina D abaxial lamina E stipes F gametophytes. Photographed by C.-W. Chen.

Figure 2. 

Lindsaea kohkongensis I.C.Hwang, M.O.Moon & B.Y.Sun (Chen Wade5034) A habit B rhizome C adaxial lamina D abaxial lamina E venation F rhizome scales. Photographed by C.-W. Chen.

Figure 3. 

Comparison of Pteris pseudowulaiensis C.M.Kuo (A, B, C, Chao 3509 and 3517) and P. oshimensis Hieron. (D, Bon 4758) A habit B lamina (backlight) C specimen D specimen, CC BY © The Trustees of the Natural History Museum, London. Photographed by C.-W. Chen and Y.-S. Chao.

Additionally, we performed phylogenetic analyses to elucidate the placements of Lindsaea kohkongensis (Fig. 2) and Leptochilus poilanei (C.Chr. & Tardieu) Liang Zhang & Li Bing Zhang (Fig. 4). In 2018, we collected an unknown Lindsaea specimen from Phu Quoc Island of southern Vietnam. This specimen closely resembles L. ensifolia Sw. but being much smaller and with an unusual subaquatic habit. Specimens from Cambodia and Malaysia with the same morphology had recently been described as Lindsaea kohkongensis (Yun et al. 2023) but without molecular data. Here, we conducted a phylogenetic analysis to test whether L. kohkongensis is a distinct species or an eco-form of L. ensifolia.

Figure 4. 

Leptochilus poilanei (C.Chr. & Tardieu) Liang Zhang & Li Bing Zhang (Chen Wade6804) A habitat B habit C rhizome scales D sterile frond E fertile frond F cross section of rhizome. Photographed by C.-W. Chen.

Leptochilus poilanei was described by Christensen and Tardieu-Blot (1939) under the genus Colysis (≡ Leptochilus), based on specimens collected from Annam, which is now part of central Vietnam. Following its initial description, the species remained largely unstudied until Zhang et al. (2018) reclassified it under Leptochilus. To our knowledge, this species is only known from its type collection, and our new collection (Fig. 4) from Nui Chua National Park represents the second collection of this species. It can be readily distinguished from other congeneric species in Vietnam by its strongly dimorphic fronds: fertile fronds are mostly linear and simple (rarely tripartite), while sterile ones are simple to pinnatifid.

Lastly, we presented new chromosome counts of Vietnamese fern species and explored the implications of our findings in the context of systematics. Chromosome numbers have long been recognized as important information in plant systematics (Rice et al. 2015). This significance is particularly pronounced for ferns, as they exhibit the highest frequency of polyploid speciation among vascular plants (Wood et al. 2009). Despite the importance of chromosome number data, research on Vietnamese ferns in this regard has been limited. To date, no systematic survey has been conducted. Instead, available data remains sporadic and dispersed throughout various articles, often in the context of new species’ descriptions (e.g., Chen et al. 2023), new species records (e.g., Ding et al. 2013), or cytological studies focused on specific taxa, including specimens collected from Vietnam (e.g., Nayak and Singh 1989). By reporting the chromosome numbers of Vietnamese fern species and demonstrating how these data can be integrated into systematic studies, we aim to raise awareness of chromosome studies among local botanists, thereby encouraging further related research in the future.

Materials and methods

Specimen identification and distribution

We conducted field expeditions in Bidoup Nui-Ba National Park, Cuc Phuong National Park, Phia Oac-Phia Den National Park, Phu Quoc National park, and Nui Chua National Park during 2018–2023. To ensure the correct identifications of our newly collected specimens, we compared them with herbarium specimens, relevant literature, including published papers, checklist, and flora from neighboring countries (see notes under each species), and original protologues and types through the Biodiversity Heritage Library (https://www.biodiversitylibrary.org/) and JSTOR Global Plants (https://plants.jstor.org/). To confirm the known distribution of each species, we searched the names against World Ferns (Hassler 1994–2024) and GBIF (https://www.gbif.org/) and manually examined the available specimen images.

Cytological observations

To determine chromosome numbers, root tips were collected either from the field or transplanted plants in greenhouses. These root tips were treated with a 1:1 mixture of hydroxyquinoline and cycloheximide (Sigma-Aldrich, USA) for approximately 16 hours at 18 °C. Following this, the root tips were fixed in a 3:1 mixture of 95% ethanol and 45% acetic acid for about 12 hours at room temperature. Subsequently, the root tips were macerated using a 1:1 mixture of cellulase (Yakult, Japan) and pectolyase (Sigma-Aldrich, USA) for 1 hour at 37 °C. Finally, the treated root tips were squashed in 2% acetocarmine and observed under a microscope (Zeiss Axio Imager A1, Germany). To determine the ploidy of our observed chromosome numbers, we consulted two online databases, Chromosome Counts Database (CCDB, Rice et al. 2015) and Index to Plant Chromosome Numbers (IPCN, Goldblatt and Lowry 2011), and considered the lowest sporophytic counts known for a genus as the diploid.

Furthermore, we counted the spore numbers per sporangium and observed the spore shape regularity to determine the reproductive modes whenever possible. We also compared the spore sizes of Leptochilus cantoniensis (Baker) Ching and L. poilanei by measuring 30 spores from each species.

Molecular phylogenetic analysis

To elucidate the phylogenetic placement of Lindsaea kohkongensis and Leptochilus poilanei, we conducted two phylogenetic analyses each based on three chloroplast markers including matK, trnH-psbA, and trnL-F for Lindsaea and rbcL, rps4-trnS, and trnL-F for Leptochilus. These markers were chosen to integrate our newly generated sequences into previous studies (Lehtonen et al. 2010; Zhang et al. 2019; Chen et al. 2020a; Fujiwara et al. 2023). We extracted genomic DNA from fresh fronds using Qiagen DNeasy Plant Mini Kit (Hilden, Germany), following the manufacturer’s protocol. We conducted PCR to amplify the five DNA markers using the primers listed in Table 1.

Table 1.
Download as
CSV
XLSX

PCR Primers used in this study.

Region Name Sequence 5’ to 3’ Reference
matK FERN matK fEDR ATTCATTCRATRTTTTTATTTHTGGARGAYAGATT Kuo et al. 2011
matK DeLin matK rNRD CTACGCAAYSCATCYCGATTT Kuo et al. 2011
rbcL 1F ATGTCACCACAAACAGAAAC Fay et al. 1997
rbcL 1379R TCACAAGCAGCAGCTAGTTCAGGACTC Wolf et al. 1999
rps4-trnS rps5 ATGTCCCGTTATCGAGGACCT Nadot et al. 1995
rps4-trnS trnSR TACCGAGGGTTCGAATC Smith and Cranfill 2002
trnH-psbA trnH CGCGCATGGTGGATTCACAATCC Tate and Simpson 2003
trnH-psbA psbA3’f GTTATGCATGAACGTAATGCTC Sang et al. 1997
trnL-F FernL1Ir1 GGYAATCCTGAGCCAAATC Li et al. 2009
trnL-F F ATTTGAACTGGTGACACGAG Taberlet et al. 1991

For Lindsaea, we included the sequences of 26 specimens as listed in Appendix 1: Table A1. Among these, the sequences of 14 specimens were downloaded from GenBank. To test the monophyly of L. ensifolia, this sampling included 1) L. ensifolia from a broad geographic range, including Bangladesh, Brunei, Cambodia, India, Malaysia, Nepal, Solomon Islands, Thailand, and Vietnam; and 2) closely related species identified by Lehtonen et al. (2010). For Leptochilus, in addition to our newly sequenced L. poilanei, we download the sequences of another 21 specimens from GenBank. In total, 22 specimens representing 19 species were included in the phylogenetic analysis as listed in Appendix 1: Table A2. This sampling covered all the major clades found in previous studies (Zhang et al. 2019; Chen et al. 2020a).

For our newly generated sequences, we first manually inspected raw reads, removing any ambiguous bases using BioEdit (Hall 1999). Subsequently, we aligned the sequences of each marker using MUSCLE (Edgar 2004) with default settings. These individual marker alignments were then concatenated into a single alignment, because chloroplast genome is non-recombining and therefore has a single evolutionary history. We then conducted maximum likelihood (ML) analyses using IQTREE (Minh et al. 2020) each with five partitions (three codon positions for matK and rbcL, and rps4-trnS, trnH-psbA and trnL-F, each treated as a single partition for simplification although they contain partly coding regions). The best-fit model for each partition and the best-fit partition scheme were determined by ModelFinder (Lanfear et al. 2012; Kalyaanamoorthy et al. 2017) as implemented in IQTREE (Minh et al. 2020). To assess branch support, we performed 1000 ultrafast bootstrap replicates using UFBoot (Hoang et al. 2018). The two concatenated alignments and the resulting phylogenetic trees are available on the Dryad Digital Repository (Chen et al. 2024).

Results

Phylogenetic placement of Lindsaea kohkongensis

The concatenated three-marker alignment contains 1832 bp including 85 parsimony informative sites and 39.2% missing data (17,973 bp). ModelFinder merged all the five partitions into one alignment with the best-fit model identified as K3Pu+F+R2. The phylogram generated by the ML analysis based on the concatenated alignment is shown in Fig. 5. The inferred species relationships closely align with the phylogeny reconstructed by Lehtonen et al. (2010) although the nodes are poorly supported in general. However, Lindsaea kohkongensis is strongly supported as the sister group to a clade comprising all the L. ensifolia specimens included in this analysis.

Figure 5. 

Phylogram of Lindsaea reconstructed from the maximum likelihood analysis of the concatenated plastid dataset (matK, trnH-psbA, and trnL-F). The branch length to the outgroup Tapeinidium is not to scale for better visualization. Support values below 80 are not shown on the nodes. L. kohkongensis is indicated in bold.

Phylogenetic placement of Leptochilus poilanei

The concatenated three-marker alignment contains 3331 bp including 248 parsimony informative sites and 17.8% missing data (13077 bp). ModelFinder subset the alignment into two partitions, the first including first and third codon position of rbcL, and the second including the second codon position of rbcL along with rps4-trnS and trnL-F. The best-fit models determined for the two partitions were TNe+I+G4 and K3Pu+F+R2, respectively. The phylogram generated by the ML analysis based on the concatenated alignment is shown in Fig. 6. The inferred species relationships are similar to previous studies (Zhang et al. 2019; Chen et al. 2020a) as expected, although poorly supported in general. Leptochilus poilanei is nested in a highly supported clade containing three specimens of L. cantoniensis.

Figure 6. 

Phylogram of Leptochilus reconstructed from the maximum likelihood analysis of the concatenated plastid dataset (rbcL, rps4-trnS, and trnL-F). Support values below 80 are not shown on the nodes. L. poilanei is indicated in bold.

Both L. cantoniensis (based on Hsu 3399) and L. poilanei (based on Chen Wade6804) produce 64 spores in each sporangium with normal morphology. The spore size of L. cantoniensis and L. poilanei is 44.3 ± 3.4 and 63.0 ± 4.9 µm, respectively. The spores of L. poilanei are significantly larger than those of L. cantoniensis (t-test, p < 0.001).

Chromosome number of 20 species

We successfully counted the chromosome numbers of 20 species, each determined by multiple cells. Their chromosome numbers and ploidy levels inferred from the known lowest base number are shown in Table 2. Figs 7–13 illustrated representative cells for all the 20 species. Among these, chromosome numbers were recorded for the first time for seven species: Gymnosphaera salletii (Tardieu & C.Chr.) S.Y.Dong, Lepisorus spicatus (L.f.) Li Wang, Leptochilus poilanei, Pteridrys costularis Li Bing Zhang, Liang Zhang, N.T.Lu & X.M.Zhou, Pteris latipinna Y.S.Chao & W.L.Chiou, Pyrrosia eberhardtii (Christ) Ching, and Tectaria setulosa (Baker) Holttum. Furthermore, we reported the new cytotypes for three species: Diplazium doederleinii (Luerss.) Makino, Pteris esquirolii H.Christ, and Tectaria harlandii (Hook.) C.M.Kuo.

Table 2.
Download as
CSV
XLSX

Plant materials used in this study for chromosome counting, their inferred ploidy, spores number in each sporangium (s/s), and corresponding figures. Asterisks “*” indicate newly reported species. Hash marks “#” indicate newly reported cytotypes. Em-dashes “—” indicate missing data.

Taxa Voucher Chromosome no. Ploidy s/s Figure
Asplenium normale D.Don Chen Wade5121 2n = 72 2x 64 7A
Asplenium tenerum G.Forst. Chen Wade5342 2n = 144 4x 64 7B
Ctenitis eatonii (Baker) Ching Chen Wade6815 2n = 82 2x — 7C
Didymochlaena truncatula (Sw.) J.Sm Chen Wade5817 2n = 82 2x 64 8A
Diplazium doederleinii (Luerss.) Makino# Chao 3524 2n = 82 2x 64 8B
Diplazium donianum (Mett.) Tardieu Chen Wade6853 2n = 123 3x — 8C
Grypothrix simplex (Hook.) S.E.Fawc. & A.R.Sm Chen Wade6879 2n = 72 2x 64 9A
Gymnosphaera salletii (Tardieu & C.Chr.) S.Y.Dong* Chen Wade6586 2n = 138 2x 64 9B
Lepisorus spicatus (L.f.) Li Wang* Chen Wade6598 2n = 70 2x — 9C
Leptochilus poilanei (C.Chr. & Tardieu) Liang Zhang & Li Bing Zhang* Chen Wade6804 2n = 144 4x 64 10A
Pleocnemia winitii Holttum Chao 3534 2n = 82 2x 64 10B
Polystichum biaristatum (Blume) T.Moore Chen Wade5070 2n = 82 2x 64 10C
Pteridrys costularis Li Bing Zhang, Liang Zhang, N.T.Lu & X.M.Zhou* Chen Wade6819 2n = 82 2x — 11A
Pteris cadieri H.Christ Chen Wade5737, Chao 3501 2n = 87 3x 32 11B, 11C
Pteris esquirolii H.Christ# Chao 3511 2n = 58 2x 64 12A
Pteris latipinna Y.S.Chao & W.L.Chiou* Chao 3526 2n = 58 2x 32 12B
Pteris pseudowulaiensis C.M.Kuo Chao 3515 2n = 58 2x 32 12C
Pyrrosia eberhardtii (Christ) Ching* Chen Wade5607 2n = 74 2x — 13A
Tectaria harlandii (Hook.) C.M.Kuo# Chen Wade6874 2n = 80 2x — 13B
Tectaria setulosa (Baker) Holttum * Chen Wade6852 2n = 80 2x 64 13C
Figure 7. 

Mitotic chromosomes with explanatory illustrations A Asplenium normale (2n = 72) B Asplenium tenerum (2n = 144) C Ctenitis eatonii (2n = 82).

Figure 8. 

Mitotic chromosomes with explanatory illustrations A Didymochlaena truncatula (2n = 82) B Diplazium doederleinii (2n = 82) C Diplazium donianum (2n = 123).

Figure 9. 

Mitotic chromosomes with explanatory illustrations A Grypothrix simplex (2n = 72) B Gymnosphaera salletii (2n = 138) C Lepisorus spicatus (2n = 70).

Figure 11. 

Mitotic chromosomes with explanatory illustrations A Pteridrys costularis (2n = 82) B Pteris cadieri (2n = 87) C Pteris cadieri (2n = 87).

Figure 10. 

Mitotic chromosomes with explanatory illustrations A Leptochilus poilanei (2n = 144) B Pleocnemia winitii (2n = 82) C Polystichum biaristatum (2n = 82).

Figure 12. 

Mitotic chromosomes with explanatory illustrations A Pteris esquirolii (2n = 58) B Pteris latipinna (2n = 58) C Pteris pseudowulaiensis (2n = 58).

Figure 13. 

Mitotic chromosomes with explanatory illustrations A Pyrrosia eberhardtii (2n = 74) B Tectaria harlandii (2n = 80) C Tectaria setulosa (2n = 80).

Discussion

Systematic uniqueness of Lindsaea kohkongensis

When we collected this species from Phu Quoc island in 2018, we were hesitant to describe it. Morphologically, it closely resembles L. ensifolia, leading us to question if it might be an eco-form of the latter. In this study, we conducted a phylogenetic analysis based on three chloroplast regions, sampling L. ensifolia from a wide geographic distribution throughout Asia and the Pacific Islands. The results indicate that L. kohkongensis is sister to L. ensifolia rather than being embedded within it (Fig. 6). On one hand, this suggests that L. kohkongensis can be recognized as a distinct species based on the principle of monophyly. On the other hand, it could also be classified within a broadly circumscribed L. ensifolia. To our knowledge, L. ensifolia typically grows terrestrially in a diverse habitat from swampy forests, dipterocarp forests, to exposed grasslands (Kramer 1971; personal observation). In contrast, L. kohkongensis is exclusively found in shaded valleys as lithophytes and is frequently submerged in water (Yun et al. 2023; personal observation). This distinction suggests an ecological speciation event that needs to be tested in the future.

While identifying our specimen from Phu Quoc island, we came across a rheophyte form of L. ensifolia described as L. ensifolia var. rheophila K.Iwats from Sumatra (Iwatsuki 1977). After examining the type materials deposited in KYO, we concluded that this is the same species as L. kohkongensis and should be treated as a synonym of it. As noted by Kramer (1967), L. ensifolia is one of the most widespread and variable species of the genus. Apart from var. rheophila, few other subspecies or varieties have been published, such as subsp. coriacea (Alderw.) K.U.Kramer from Bornean swamp forests. Furthermore, ploidy variations (diploid, triploid, and tetraploid) and different reproductive modes (sexual and apomixis) have been observed in L. ensifolia (e.g., Lin et al. 1996). Although we here tentatively recognize L. kohkongensis as a distinct species, the variability observed in L. ensifolia underscores the need for a systematic study of this complex species.

Hybrid origin hypothesis of Leptochilus poilanei

Our phylogenetic analysis based on three plastid markers unambiguously resolves L. poilanei within a clade that includes three specimens of L. cantoniensis (Fig. 6). This result is unexpected, considering the clear morphological distinctions between these two species. Specifically, fully developed sterile fronds of L. poilanei are pinnatifid, while those of L. cantoniensis remain consistently simple (Fig. 14).

Figure 14. 

Comparison of the sterile fronds between Leptochilus cantoniensis and L. poilanei A L. cantoniensis, based on Kuo 1701 (TAIF [509328], left), Cadière 158 (MICH [1191289], middle), and s.c., s.n. (K [000959730], right) B L. poilanei, based on Poilane 5373 (BM [000036782], all the three fronds).

Our examination of the reproductive mode indicates that both species undergo sexual reproduction, as evidenced by the production of 64 well-formed spores in each sporangium. The mitotic chromosome count for L. poilanei is 2n = 144 (Fig. 10A), suggesting it is a tetraploid, given the base number of the genus is x = 36 (Rice et al. 2015). Although the chromosome number of L. cantoniensis is presently unknown, its spores are significantly smaller than those of L. poilanei (44.3 ± 3.4 vs. 63.0 ± 4.9 µm). Considering the widely found correlation between ploidy and spore size in ferns (Barrington et al. 1986), we propose that L. cantoniensis is likely a diploid species.

Building on the evidence from our study, we propose that L. poilanei has a hybrid origin. We suggest that L. poilanei originated from hybridization between L. cantoniensis (as the maternal parent, considering chloroplast inheritance in ferns, e.g., Gastony and Yatskievych 1992) and an unidentified diploid species, followed by polyploidization. The close similarity in chloroplast DNA markers between L. cantoniensis and L. poilanei suggests a relatively recent hybridization event. This hypothesis gains further support from the overlapping distribution of L. cantoniensis and L. poilanei in central Vietnam. While the identity of the other parent remains elusive, we anticipate it is likely a species with pinnatifid fronds, given that L. poilanei exhibits this characteristic. Future studies employing bi-parentally inherited nuclear markers and comprehensive sampling of the genus in Vietnam are essential to test our hypothesis.

New findings of chromosome number

In the following paragraphs, we discussed the systematic implications of our new finding (i.e., new species counts or new cytotypes) species by species, following alphabetical order.

Diplazium doederleinii (Luerss.) Makino—2n = 82, sexual diploid, Fig. 8B

Previous studies reported triploid (2n = 123) and tetraploid (2n = 164) specimens from Japan (Takamiya et al. 2001). Our discovery of a diploid specimen from Vietnam provides further support for the long-observed cytogeographic pattern: diploids are typically found in warmer tropics, whereas polyploids are prevalent in cooler temperate regions (e.g. Chang et al. 2013). As demonstrated by Takamiya et al. (2001), there is a little genetic divergence between triploids and tetraploids. Future studies could incorporate the newly discovered diploid into genetic analyses to further investigate the origins of polyploids.

Gymnosphaera salletii (Tardieu & C.Chr.) S.Y.Dong—2n = 138, sexual diploid, Fig. 9B

The first chromosome count reported for the species. This Vietnam endemic species was recently reevaluated by Li et al. (2024), who described two new species previously been misidentified as G. salletii. Gymnosphaera is predominantly a paleotropical genus, comprising approximately 46 species (Dong and Zuo 2018). All four previously reported species with chromosome counts in the genus are diploid, namely G. capensis (L.f.) S.Y.Dong, G. gigantea (Wall. ex Hook.) S.Y.Dong, G. khasyana (T.Moore ex Kuhn) Ching, and G. podophylla (Hook.) Copel. (Manton and Sledge 1954; Löve et al. 1977; Kato 1999). Notably, there is a correlation between geographic distribution and the basic chromosome number: all Asian species exhibit x = 69, while African species have x = 70.

Lepisorus spicatus (L.f.) Li Wang—2n = 70, diploid, Fig. 9C

The first chromosome count reported for the species. Found across the paleotropics, this species has often been confused with L. mucronatus (Fée) Li Wang. Following Hovenkamp (1998), we identify the species by the presence of entire rhizome scales with hyaline margins. Following Zhao et al. (2020), this species belongs to sectiob Belvisia (Mirb.) C.F. Zhao, R.Wei & X.C. Zhang, a small clade comprising eight species (Hovenkamp and Franken 1993). Lepisorus mucronatus is the only other species in this section with known chromosome numbers and has been determined as tetraploid (2n = 140) from Australia (Tindale and Roy 2002).

Leptochilus poilanei (C.Chr. & Tardieu) Liang Zhang & Li Bing Zhang—2n = 144, sexual tetraploid, Fig. 10A

As discussed in previous sections, we hypothesize that this Vietnam endemic species originated from a hybridization between L. cantoniensis and an unidentified diploid species, followed by polyploidization. Leptochilus is predominantly a tropical Asian genus with approximately 51 species (Zhang et al. 2024). Prior to this study, chromosome numbers were known for only four species including: L. axillaris (Cav.) Kaulf., L. decurrens Blume, L. ellipticus (Thunb.) Noot., and L. pothifolius (Buch.-Ham. ex D.Don) Fraser-Jenk. (e.g., Mitui 1968; Löve et al. 1977; Manickam and Irudayaraj 1989). Among these four species, L. decurrens is the only one reported to exist in both diploids and tetraploids, while the other three species are known only as diploids.

Pteridrys costularis Li Bing Zhang, Liang Zhang, N.T.Lu & X.M.Zhou—2n = 82, diploid, Fig. 11A

The first chromosome count reported for the species. Pteridrys is a tropical Asian genus with ca. 22 species, and 11 of them are recorded in Vietnam (Zhou and Zhang 2019). So far, all the four species (the other three are P. australis Ching ex C.Chr. & Ching, P. cnemidaria (Christ) C.Chr.et.Ching, and P. syrmatica (Willd.) C.Chr. & Ching) with reported chromosome numbers are diploids (Manton 1954; Tsai and Shieh 1985; Bidin and Go 1995).

Pteris esquirolii H.Christ—2n = 58, sexual diploid, Fig. 12A

This species is reported from southern China, Taiwan, and Vietnam (Chao 2019). Prior to this study, the only reported chromosome count was 2n = ca. 90 (presumably an apogamous triploid due to the count of 32 spores per sporangium) from southern China (Lin et al. 2002). Although Chao (2019) found very little genetic divergence among populations from China and Taiwan, it may be worthwhile to include the Vietnamese population in future analyses, given their different ploidy level and reproductive mode. This is particularly important considering the prevalence of reticulate evolution observed in the genus (e.g., Chao et al. 2012, 2022).

Pteris latipinna Y.S.Chao & W.L.Chiou—2n = 58, apogamous diploid, Fig. 12B

This is the first chromosome count reported for this species. This species was firstly described from Taiwan (Chao et al. 2017) and later reported from China and Vietnam (Chen et al. 2020b). Our chromosome counts support the hypothesis proposed by Chao et al. (2022) that P. latipinna is a diploid, as indicated by flow cytometry. Our spore number counts also confirm that P. latipinna is reproduced through apogamous reproduction, which is common for the genus (Walker 1962).

Pyrrosia eberhardtii (Christ) Ching—2n = 74, diploid, Fig. 13A

The first chromosome count reported for the species. This species is recorded in southern China, Thailand, and Vietnam, with its type locality in Vietnam. It has sometimes been grouped under a broadly defined P. lingua (Thunb.) Farw. alongside other closely related species such as P. oblonga Ching and P. heteractis (Mett.) Ching. (Hovenkamp 1986). This broader classification of P. lingua is further supported by Zhou et al. (2017), showing a close relationship among these species. The chromosome numbers of P. lingua have been reported from China and Japan, and both are diploids (e.g., Takei 1969; Kato 1999).

Tectaria harlandii (Hook.) C.M.Kuo—2n = 80, diploid, Fig. 13B

This species has been documented in the Ryukyu Islands, southern China, northern Vietnam, and Taiwan. Tetraploid populations (n = 80) have been reported in the Ryukyu Islands (as Hemigramma decurrens (Hook.) Copel., Mitui 1976) and Taiwan (Tsai and Shieh 1985). In our study, we provide the first record of a diploid form Vietnam. Notably, this species has been proposed as the maternal parent of the triploid (2n = 120) sterile hybrid species T. × hongkongensis (Zhao and Dong 2016), with T. zeilanica (Houtt.) Sledge as the paternal parent. It is reasonable to assume that T. × hongkongensis originated from the hybridization between diploid and tetraploid parents. Given that both diploids and tetraploids are now confirmed in these two parental species (Manton and Sledge 1954; Tsai and Shieh 1985), it would be interesting to investigate whether there is a bias in the direction of hybridization based on ploidy level.

Tectaria setulosa (Baker) Holttum—2n = 80, sexual diploid, Fig. 13C

The first chromosome count reported for the species. Initially described from Ba Vi mountain range in northern Vietnam, this species has since been documented in southern China, Indochina, and Peninsular Malaysia. Additionally, a variety raciborskii (Alderw.) Holttum has been further identified extending to Java without known ploidy.

New records from Vietnam

Haplopteris yakushimensis C.W.Chen & Ebihara, Phytotaxa 156(4): 232. 2014.

Fig. 1

Type.

Japan. • Kagoshima Pref., Yakushima Island, Nakabase River, 20 Aug 1982, Nakaike s.n. (holotype TNS [VS-456666!]).

Distribution and ecology.

This species was previously recorded only in Japan and Taiwan (Chen et al. 2014, TPG 2019). In Vietnam, H. yakushimensis is found in damp evergreen broadleaf forests at elevations of 1200–1360 m, where it grows on rocks with thick compost near streams.

Specimens examined.

Vietnam. • Cao Bang Province: Phia-Oac Phia-Den National Park, 6 Dec 2013, Zhang et al. 6755 (MO, TAIF [499240!], VNMN). Phia-Oac Phia-Den National Park, Nguyen Binh District, Thanh Cong Ward, 22.589539°N, 105.880403°E, 1353 m, 8 Nov 2023, Chen Wade6952 (TAIF!, VNMN!). • Ha Giang Province: Vi Xuyen District, Cao Bo Ward, 22.767500°N, 104.880394°E, 1200–1360 m, 12 Sep 2000, Harder et al. 5514 (UC [1763099!]).

Note.

Haplopteris, a fern genus comprising approximately 40 species, is primarily found in tropical Africa, Asia, and the Pacific Islands (Schuettpelz et al. 2016). In Vietnam, eight Haplopteris species were previously recorded: H. angustifolia (Blume) E.H.Crane, H. doniana (Mett. ex Hieron.) E.H.Crane, H. elongata (Sw.) E.H.Crane, H. ensata (Christ) C.W.Chen & S.Linds., H. ensiformis (Sw.) E.H.Crane, H. flexuosa (Fée) E.H.Crane, H. hainanensis (C.Chr. ex Ching) E.H.Crane, and H. sikkimensis (Kuhn) E.H.Crane (Chen et al. 2023). Haplopteris yakushimensis can be distinguished from these species by having fronds broader than 1 cm wide, costae that are grooved on the adaxial side and raised on the abaxial side, and the submarginal (ca. 1–2 mm away from the margins) sori lines.

Recent studies have identified two genetically distinct yet morphologically indistinguishable lineages in H. yakushimensis (Kuo et al. 2017; TPG 2019). With the discovery of new populations in Vietnam, we are currently working to clarify these lineages using an integrated approach that includes reproductive biology, genome size estimation, and nuclear markers. The results of this research will be published in a separate paper.

Lindsaea kohkongensis I.C.Hwang, M.O.Moon & B.Y.Sun, Korean J. Pl. Taxon. 53(4): 289. 2023.

Fig. 2

Type.

Cambodia • Koh Kong, Thma Bang District, near Chamnar village, 22 Dec 2013, Sun et al. C5520 (holotype HIBR; isotypes HIBR, KB).

Distribution and ecology.

This species was recently described from Cambodia and Malaysia. In Vietnam, it grows along a valley in damp tropical forests as lithophytes and is frequently submerged in water.

Specimens examined.

Vietnam. • Kien Giang Province: Phu Quoc district, Phu Quoc National Park, 6 Mar 2018, Chen Wade5034 (TAIF [514046!]).

Note.

Morphologically, this species closely resembles Lindsaea ensifolia. Although L. kohkongensis is usually a much smaller species than L. ensifolia, we did not identify any qualitative trait to distinguish them. Currently, subaquatic habitat preference appears to be the most reliable characteristic for differentiating this species from L. ensifolia. Yun et al. (2023) described L. kohkongensis as having free venation, in contrast to the anastomosing venation found in L. ensifolia. However, this is not true. As demonstrated in Fig. 3G of their paper and Fig. 2F of the current study, the veins of L. kohkongensis are connected near the lamina margin, forming areoles in fertile fronds.

Pteris pseudowulaiensis Y.S.Chao, Taiwania 66(3): 314. 2021.

Fig. 3

Type.

Taiwan • New Taipei, Mt. Pataoerh, 600–700 m, 29 Apr 2016, Hsu 8437 (holotype TAIF [497137!]; isotype TAIF [497138!]).

Distribution and ecology.

This species, recently described from Taiwan, was initially reported from southern China and Taiwan (Chao et al. 2021). In Vietnam, P. pseudowulaiensis was discovered in relatively dry evergreen broadleaf forests at lowland areas of Cuc Phuong National Park.

Specimens examined.

Vietnam • Ninh Binh Province: Cuc Phuong National Park, Muong Khu trail, Y.-S. Chao 3509, 3515, 3517, 3531 (TAIF!, VNMN!).

Note.

This species belongs to the Pteris fauriei Hieron. complex, a taxonomically challenging group due to its reticulate evolution involving hybridization, polyploidization, and apomixis (Chao et al. 2022). In Vietnam, five species from this complex have been recorded, namely P. arisanensis Tagawa (Chao et al. 2022), P. kawabatae Sa.Kurata (Chao et al. 2021), P. latipinna Y.S.Chao & W.L.Chiou (Chen et al. 2020b), P. oshimensis Hieron. (Liao et al. 2013), and P. pseudowulaiensis. Morphologically, P. pseudowulaiensis closely resembles P. oshimensis but differs by having broader pinnae, measuring 2–3.5 cm compared to less than 2 cm in P. oshimensis. According to Chao et al. (2022), P. pseudowulaiensis is an apogamous diploid originating from hybridization of P. wulaiensis C.M.Kuo (a species reported from Japan and Taiwan) and another unknown species.

Acknowledgements

We extend our gratitude to Hoang Thi Nha, Nong Minh Hoan, Ly Ton Senh, Trong Tin Tran Vo, and Cong Ty Tu for their assistance during fieldwork. Our sincere thanks also go to the directors of Bidoup Nui-Ba National Park, Cuc Phuong National Park, Phia Oac-Phia Den National Park, Phu Quoc National Park, and Nui Chua National Park, as well as the Vietnam Academy of Science and Technology, for granting us the collection permits. We thank Li-Bing Zhang for sharing his duplicated specimen of Haplopteris yakushimensis with us. We are indebted to the curator and staff of the BM herbarium for granting us access to their specimen.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

Field work in Nui Chua National Park was supported by the Vietnam Academy of Science and Technology (UDNGDP.01/24-25). Funding for this study was provided by the National Science and Technology Council of Taiwan (NSTC 112-2621-B-054-001-MY3).

Author contributions

CWC conceptualizes the study, conducts the analysis, and writes the original draft. CWC, YMH, YSC collect the data. YMH and KFC provide lab equipment. All authors conduct field work and revise the manuscript.

Author ORCIDs

Cheng-Wei Chen https://orcid.org/0000-0001-9709-6739

Van Truong Do https://orcid.org/0000-0002-0585-5513

Hong Truong Luu https://orcid.org/0000-0002-7036-7081

Yi-Shan Chao https://orcid.org/0000-0001-7433-5987

Kuo-Fang Chung https://orcid.org/0000-0003-3628-2567

Data availability

All of the data that support the findings of this study are available in the main text.

References

  • Barrington DS, Paris CA, Ranker TA (1986) Systematic inferences from spore and stomate size in the ferns. American Fern Journal 76: 149–159. https://doi.org/10.2307/1547723
  • Bidin AA, Go R (1995) Chromosome base numbers for Tectaria and allied genera in peninsular Malaysia. Natural History Research (Chiba) 3: 115–122.
  • Chang Y, Li J, Lu S, Schneider H (2013) Species diversity and reticulate evolution in the Asplenium normale complex (Aspleniaceae) in China and adjacent areas. Taxon 62: 673–687. https://doi.org/10.12705/624.6
  • Chao YS, Dong SY, Chiang YC, Liu HY, Chiou WL (2012) Extreme multiple reticulate origins of the Pteris cadieri complex (Pteridaceae). International Journal of Molecular Sciences 13: 4523–4544. https://doi.org/10.3390/ijms13044523
  • Chao YS, Chiou WL, Ebihara A, Hsu TC, Chang YH, Lin CY (2021) Taxonomic and nomenclatural novelties in the Pteris fauriei group (Pteridaceae). Taiwania 66: 307–316.
  • Chen CW, Ebihara A, Chiou WL, Li CW (2014) Haplopteris yakushimensis (Pteridaceae, Vittarioideae), a new species from Yakushima Island, Japan. Phytotaxa 156: 229–234. https://doi.org/10.11646/phytotaxa.156.4.5
  • Chen CC, Hyvönen J, Schneider H (2020a) Exploring phylogeny of the microsoroid ferns (Polypodiaceae) based on six plastid DNA markers. Molecular Phylogenetics and Evolution 143: 106665. https://doi.org/10.1016/j.ympev.2019.106665
  • Chen CW, Hsu TC, Chao YS, Lu PF, Li CW, Tram NKT, Nguyen ILPT, Dang MT, Luu HT, Parris B (2020b) A newly recorded genus and twelve newly recorded species of ferns for Vietnam from Lang Biang Plateau. Phytotaxa 443: 121–143. https://doi.org/10.11646/phytotaxa.443.2.1
  • Christensen C, Tardieu-Blot ML (1939) Les fougeres d’Indochine. XV. Dipteroideae, XVI. Polypodioideae, XVII. Elaphoglossoideae. Notulae Systematicae 8: 175–210.
  • Ding HH, Wang P, Dong SY (2013) Dryopsis (Dryopteridaceae), a fern genus new to Vietnam. Taiwania 58: 80–84.
  • Dong SY, Zuo ZY (2018) On the recognition of Gymnosphaera as a distinct genus in Cyatheaceae. Annals of the Missouri Botanical Garden 103: 1–23. https://doi.org/10.3417/2017049
  • Fay MF, Swensen SM, Chase MW (1997) Taxonomic affinities of Medusagyne oppositifolia (Medusagynaceae). Kew Bulletin 52: 111–120. https://doi.org/10.2307/4117844
  • Fujiwara T, Quang BH, Tagane S, Murakami N, Oguri E (2023) Leptochilus ornithopus (Polypodiaceae), a new hemiepiphytic fern species from central highlands of Vietnam. Phytotaxa 584: 149–160. https://doi.org/10.11646/phytotaxa.584.3.2
  • Goldblatt P, Lowry PP (2011) The Index to Plant Chromosome Numbers (IPCN): Three decades of publication by the Missouri Botanical Garden come to an end. Annals of the Missouri Botanical Garden 98: 226–227. https://doi.org/10.3417/2011027
  • Hall TA (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98.
  • Hassler M (1994–2024) World ferns. Synonymic checklist and distribution of ferns and lycophytes of the world. https://www.worldplants.de/ferns/ [last accessed 9 Nov 2024]
  • Hoang DT, Chernomor O, Von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35: 518–522. https://doi.org/10.1093/molbev/msx281
  • Hovenkamp PH (1998) Polypodiaceae. Flora Malesiana-Series 2. Pteridophyta 3: 1–234.
  • Hovenkamp PH, Franken NAP (1993) An account of the fern genus Belvisia Mirbel (Polypodiaceae). Blumea 37: 511–527.
  • Iwatsuki K (1977) Notes on Asiatic pteridophytes 1. Acta Phytotaxonomica et Geobotanica 28: 160–166.
  • Kalyaanamoorthy S, Minh BQ, Wong TK, Von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/nmeth.4285
  • Kato M (1999) A cytotaxonomic study of Hainan (S. China) pteridophytes with notes on polyploidy and apogamy of Chinese species. In: Zhang XC, Shing KH (Eds) Ching Memorial Volume. China Forestry Publishing House, Beijing, 1–19.
  • Kramer KU (1967) The lindsaeoid ferns of the Old World III. Notes on Lindsaea and Sphenomeris in the Flora Malesiana area. Blumea 15: 557–574.
  • Kramer KU (1971) Lindsaea-group. Flora Malesiana-Series 2. Pteridophyta 1: 177–254.
  • Kuo LY, Chen CW, Shinohara W, Ebihara A, Kudoh H, Sato H, Huang YM, Chiou WL (2017) Not only in the temperate zone: Independent gametophytes of two vittarioid ferns (Pteridaceae, Polypodiales) in East Asian subtropics. Journal of Plant Research 130: 255–262. https://doi.org/10.1007/s10265-016-0897-x
  • Lanfear R, Calcott B, Ho SY, Guindon S (2012) PartitionFinder: Combined selection of partitioning schemes and substitution models for phylogenetic analyses. Molecular Biology and Evolution 29: 1695–1701. https://doi.org/10.1093/molbev/mss020
  • Lehtonen S, Tuomisto H, Rouhan G, Christenhusz MJ (2010) Phylogenetics and classification of the pantropical fern family Lindsaeaceae. Botanical Journal of the Linnean Society 163: 305–359. https://doi.org/10.1111/j.1095-8339.2010.01063.x
  • Li FW, Tan BC, Buchbender V, Moran RC, Rouhan G, Wang CN, Quandt D (2009) Identifying a mysterious aquatic fern gametophyte. Plant Systematics and Evolution 281: 77–86. https://doi.org/10.1007/s00606-009-0188-2
  • Li SH, Zuo ZY, Chen CW, Pham VT, Luu HT, Dong SY (2024) Three out of one: Revising the species delimitation of the tree fern Gymnosphaera salletii (Cyatheaceae), with particular reference to the foliar nectary. Botanical Journal of the Linnean Society 204: 63–75. https://doi.org/10.1093/botlinnean/boad036
  • Liao W, Ding M, Wu ZY, Prado J, Gilbert MG (2013) Pteris. In: Wu ZY, Raven PH, Hong DY (Eds) Flora of China. Science Press, Missouri Botanical Garden Press, Beijing, St. Louis, 181–256.
  • Lin SJ, Iwatsuki K, Kato M (1996) Cytotaxonomic study of ferns from China, I. Species of Yunnan. Shokubutsu Kenkyu Zasshi 71: 214–222.
  • Lin SJ, Zhuang HR, Iwatsuki K, Lu HS (2002) Cytotaxonomic study of ferns from China II. Species of Fujian. Shokubutsu Kenkyu Zasshi 77: 129–138.
  • Löve A, Löve D, Pichi Sermolli REG (1977) Cytotaxonomical Atlas of the Pteridophyta. Cramer, Liechtenstein.
  • Manickam VS, Irudayaraj V (1989) Corrections to the cytology of ferns of the western Ghats. Indian Fern Journal 6: 131–132.
  • Manton I (1954) Cytology of One Hundred Ferns. Appendix in Revised Flora of Malaya, vol. 2: Ferns, Holttum RE. Government Printing Office, Singapore.
  • Manton I, Sledge WA (1954) Observations on the cytology and taxonomy of the pteridophyte flora of Ceylon. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 238: 127–185. https://doi.org/10.1098/rstb.1954.0008
  • Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, Von Haeseler A, Lanfear R (2020) IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution 37: 1530–1534. https://doi.org/10.1093/molbev/msaa015
  • Mitui K (1968) Chromosomes and speciation in ferns. Science Reports of the Tokyo Kyoiku Daigaku B 13: 185–333.
  • Mitui K (1976) Chromosome numbers of some ferns in the Rykyu Islands. Shokubutsu Kenkyu Zasshi 51: 33–41.
  • Nadot S, Bittar G, Carter L, Lacroix R, Lejeune B (1995) A phylogenetic analysis of monocotyledons based on the chloroplast gene rps4, using parsimony and a new numerical phenetics method. Molecular Phylogenetics and Evolution 4: 257–282. https://doi.org/10.1006/mpev.1995.1024
  • Rice A, Glick L, Abadi S, Einhorn M, Kopelman NM, Salman-Minkov A, Mayzel J, Chay O, Mayrose I (2015) The Chromosome Counts Database (CCDB) – a community resource of plant chromosome numbers. The New Phytologist 206: 19–26. https://doi.org/10.1111/nph.13191 [last accessed 4 Nov 2024]
  • Sang T, Crawford DJ, Stuessy TF (1997) Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84: 1120–1136. https://doi.org/10.2307/2446155
  • Schuettpelz E, Chen CW, Kessler M, Pinson JB, Johnson B, Davila A, Cochran AT, Huiet L, Pryer KM (2016) A revised generic classification of vittarioid ferns (Pteridaceae) based on molecular, micromorphological, and geographic data. Taxon 65: 708–722. https://doi.org/10.12705/654.2
  • Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of three noncoding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–1109. https://doi.org/10.1007/BF00037152
  • Takamiya M, Ohta N, Yatabe Y, Murakami N (2001) Cytological, morphological, genetic, and molecular phylogenetic studies on intraspecific differentiations within Diplazium doederleinii (Woodsiaceae: Pteridophyta). International Journal of Plant Sciences 162: 625–636. https://doi.org/10.1086/320144
  • Tate JA, Simpson BB (2003) Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Systematic Botany 28: 723–737.
  • Tindale MD, Roy SK (2002) A cytotaxonomic survey of the Pteridophyta of Australia. Australian Systematic Botany 15: 839–937. https://doi.org/10.1071/SB00034
  • TPG (2019) Updating Taiwanese pteridophyte checklist: A new phylogenetic classification. Taiwania 64: 367–395.
  • Tsai JL, Shieh WC (1985) A cytotaxonomic survey of the fern family Aspidiaceae (sensu Copeland) in Taiwan. Journal of Science and Engineering 22: 121–144.
  • Walker TG (1962) Cytology and evolution in the fern genus Pteris L. Evolution; International Journal of Organic Evolution 16: 27–43. https://doi.org/10.2307/2406264
  • Wolf PG, Sipes SD, White MR, Martines ML, Pryer KM, Smith AR, Ueda K (1999) Phylogenetic relationships of the enigmatic fern families Hymenophyllopsidaceae and Lophosoriaceae: Evidence from rbcL nucleotide sequences. Plant Systematics and Evolution 219: 263–270. https://doi.org/10.1007/BF00985583
  • Wood TE, Takebayashi N, Barker MS, Mayrose I, Greenspoon PB, Rieseberg LH (2009) The frequency of polyploid speciation in vascular plants. Proceedings of the National Academy of Sciences of the United States of America 106: 13875–13879. https://doi.org/10.1073/pnas.0811575106
  • Zhang L, Lu TN, Zhou XM, Chen DK, Knapp R, Zhou L, Gao XF, Zhang LB (2019) A plastid phylogeny of the Old World fern genus Leptochilus (Polypodiaceae): Implications for cryptic speciation and progressive colonization from lower to higher latitudes. Molecular Phylogenetics and Evolution 134: 311–322. https://doi.org/10.1016/j.ympev.2019.01.013
  • Zhang L, Lu TN, Zhou XM, Zhou Z, Thepkayson K, Luong TT, Zhang LB (2024) Exploring the diversity of the java fern genus Leptochilus (Polypodiaceae) in the Indo-Burma biodiversity hotspot. Phytotaxa 659: 213–235. https://doi.org/10.11646/phytotaxa.659.3.1
  • Zhao CF, Wei R, Zhang XC, Xiang QP (2020) Backbone phylogeny of Lepisorus (Polypodiaceae) and a novel infrageneric classification based on the total evidence from plastid and morphological data. Cladistics 36: 235–258. https://doi.org/10.1111/cla.12403
  • Zhou XM, Zhang L, Chen CW, Li CX, Huang YM, Chen DK, Lu TN, Cicuzza D, Knapp R, Luong TT, Nitta JH (2017) A plastid phylogeny and character evolution of the Old World fern genus Pyrrosia (Polypodiaceae) with the description of a new genus: Hovenkampia (Polypodiaceae). Molecular Phylogenetics and Evolution 114: 271–294. https://doi.org/10.1016/j.ympev.2017.06.020

Appendix 1

Table A1.
Download as
CSV
XLSX

Specimens of Lindsaea used for molecular phylogenetic analysis in this study. New sequences generated in this study are indicated in bold. En-dashes “–” indicate missing data.

Taxa Voucher Herbarium Country Matk Trnh-Psba Trnl-F
Lindsaea agatii (Brack.) Lehtonen & Tuomisto Chen SITW5698 TAIF [481048] Solomon Islands PQ149394 PQ149410 PQ149412
Lindsaea blotiana K.U.Kramer Rakotondrainibe 6350 P Madagascar – GU478510 GU478813
Lindsaea ensifolia Sw. Fraser-Jenkins FN29 TAIF [357318] Nepal – PQ149405 –
Lindsaea ensifolia Sw. Fraser-Jenkins FN36 TAIF [357830] India – PQ149404 –
Lindsaea ensifolia Sw. Huang 1657 TAIF [307881] Cambodia – PQ149407 –
Lindsaea ensifolia Sw. Kessler 13597 UC [1951608] Malaysia – GU478521 –
Lindsaea ensifolia Sw. Larsen 41363 AAU Thailand – GU478522 GU478853
Lindsaea ensifolia Sw. Lu 15719 TAIF [398238] Thailand PQ149396 PQ149403 PQ149416
Lindsaea ensifolia Sw. Lu 16172 TAIF [296864] Bangladesh – PQ149408 –
Lindsaea ensifolia Sw. Chen SITW5235 TAIF [480899] Solomon Islands PQ149399 PQ149402 PQ149415
Lindsaea ensifolia Sw. Chen Wade1339 TAIF [411090] Vietnam PQ149398 PQ149401 PQ149414
Lindsaea ensifolia Sw. Chen Wade1399 TAIF [411162] Vietnam PQ149397 PQ149406 PQ149417
Lindsaea fraseri Hook. Streimann 8951 L Australia – FJ360908 FJ360998
Lindsaea heterophylla Dryand. Kramer 8285 Z China – KF652043 KF652056
Lindsaea javanensis Blume Chen Wade4151 TAIF [458804] Vietnam PQ149393 PQ149409 PQ149411
Lindsaea kohkongensis I.C.Hwang, M.O.Moon & B.Y.Sun Chen Wade5034 TAIF [514046] Vietnam PQ149395 PQ149400 PQ149413
Lindsaea leptophylla Baker Raharimalala 2017 MO Madagascar – GU478509 GU478819
Lindsaea madagascariensis Baker Rakotondrainibe 6349 P Madagascar – GU478512 GU478815
Lindsaea media R.Br. van der Werff 11655 MO Australia – GU478516 GU478843
Lindsaea meifolia (Kunth) Mett. ex Kuhn Liesner 7062 MO Venezuela – GU478478 GU478783
Lindsaea orbiculata (Lam.) Mett. ex Kuhn Averyanov et al. VH4814 AAU Vietnam – FJ360922 FJ361013
Lindsaea oxyphylla Baker Gautier 2662 P Madagascar – GU478508 GU478816
Lindsaea vieillardii Mett. McKee 5304 U New Caledonia – GU478496 GU478844
Lindsaea walkerae Hook. Bostock 638 Z Australia – GU478517 GU478841
Tapeinidium luzonicum (Hook.) K.U.Kramer Kessler 13610 GOET Malaysia – GU478444 GU478751
Table A2.
Download as
CSV
XLSX

Specimens of Leptochilus used for molecular phylogenetic analysis in this study. New sequences generated in this study are indicated in bold.

Taxa Voucher Herbarium Country Rbcl Rps4-Trns Trnl-F
Leptochilus axillaris (Cav.) Kaulf. Wu 2462 KUN Laos JX103701 JX103743 JX103785
Leptochilus cantoniensis (Baker) Ching Dong 743 PE China EU482945 EU482995 EU483041
Leptochilus cantoniensis (Baker) Ching Dong 172 PE China EU482946 EU482996 EU483042
Leptochilus cantoniensis (Baker) Ching Kuo 1701 TAIF [509328] China MT137055 MH665095 MH665162
Leptochilus decurrens Blume Chen Wade1769 TAIF [388951] Indonesia MH768462 MH768527 MH768586
Leptochilus digitatus (Baker) Noot. Chao 1556 TAIF (432480) Vietnam MH665034 MH665097 MH665164
Leptochilus dissimilialatus (Bonap.) Liang Zhang & Li Bing Zhang Zhang et al. 6362 CDBI, MO, VNMN Vietnam MH768419 MH768481 MH768547
Leptochilus ellipticus (Thunb.) Noot. Chen Wade3656 TAIF [440115] Japan MH768444 MH768508 MH768572
Leptochilus evrardii (Tardieu) Liang Zhang & Li Bing Zhang Zhang et al. 8633 CDBI, MO Vietnam MH768461 MH768526 MH768585
Leptochilus flexilobus (Christ) Liang Zhang & Li Bing Zhang Chen Wade2518 TAIF [440142] China MH665042 MH665106 MH665173
Leptochilus henryi (Baker) X.C.Zhang Zhang et al. 9289 CDBI China MH768459 MH768524 MH768583
Leptochilus heterophyllus (S.K.Wu & P.K.Lôc) comb. ined. Wu WP-135 KUN Vietnam JX103688 JX103730 JX103772
Leptochilus longipes (Ching) X.C.Zhang Chen Wade4102 TAIF [458794] Vietnam MH665049 MH665114 MH665181
Leptochilus macrophyllus (Blume) Noot. Chen Wade1962 TAIF [388897] Indonesia MH768449 MH768513 MH768575
Leptochilus oblongus Li Bing Zhang, Liang Zhang & N.T.Lu Zhang et al. 6299 CDBI, MO, VNMN Vietnam MH768429 MH768491 MH768557
Leptochilus pedunculatus (Hook. & Grev.) Fraser-Jenk. Chen Wade1334 TAIF [410768] Vietnam MH051168 MH113467 MH113500
Leptochilus pentaphyllus (Baker) Liang Zhang & Li Bing Zhang Zhang 1777 KUN China MH768474 MH768539 MH768599
Leptochilus poilanei (C.Chr. & Tardieu) Liang Zhang & Li Bing Zhang Chen Wade6804 TAIF Vietnam PQ149390 PQ149391 PQ149392
Leptochilus pothifolius (Buch.-Ham. ex D.Don) Fraser-Jenk. Chen Wade2519 TAIF [440141] China MH665056 MH665122 MH665189
Leptochilus pteropus (Blume) Fraser-Jenk. Chen 1010 H Taiwan MH051176 MH113475 MH113508
Leptochilus saxicola (H.G.Zhou & Hua Li) Liang Zhang & Li Bing Zhang Wei 2017 KUN China MH768471 MH768536 MH768595
Leptochilus wrightii (Hook.) X.C.Zhang Chen 1087 H Taiwan MH051170 MH113469 MH113502
login to comment