Research Article
Print
Research Article
Description and phylogenetic position of a new species, Chrysosplenium insularis J.E.Jang, K.H.Lee & H.Y.Gil (Saxifragaceae), from the southern islands of South Korea
expand article infoJu Eun Jang‡, Beom Kyun Park‡, Kang-Hyup Lee‡, Hyuk-Jin Kim‡, Hee-Young Gil‡
‡ Korea National Arboretum, Pocheon, Republic of Korea

Corresponding author: Hee-Young Gil ( warmishe@korea.kr )

Academic editor: Hugo de Boer
© 2024 Ju Eun Jang, Beom Kyun Park, Kang-Hyup Lee, Hyuk-Jin Kim, Hee-Young Gil.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Jang JE, Park BK, Lee K-H, Kim H-J, Gil H-Y (2024) Description and phylogenetic position of a new species, Chrysosplenium insularis J.E.Jang, K.H.Lee & H.Y.Gil (Saxifragaceae), from the southern islands of South Korea. PhytoKeys 248: 91-104. https://doi.org/10.3897/phytokeys.248.131291
Open Access

Abstract

We describe a new species, Chrysosplenium insularis J.E.Jang, K.H.Lee & H.Y.Gil, belonging to the family Saxifragaceae, from the southern islands of the Republic of Korea. Chrysosplenium insularis is morphologically similar to C. japonicum (Maxim.) Makino but can be distinguished by fairly persistent bulbils, green to yellowish-green sepals, four stamens, and cylindrical papillose seeds. Chrysosplenium insularis is also distinguished from C. alternifolium L., which is distributed in Europe, northern Russia, and the Caucasus, by the absence of stolons and green bracts. Phylogenetic analyses, based on one nuclear ribosomal (ITS) and two chloroplast (rbcL, matK) regions, confirmed that the new species was monophyletic and that C. insularis and C. alternifolium formed a sister relationship with robust support. Herein, we provide a detailed morphological description of C. insularis with its corresponding geographical distribution and comparison table and figures of related species.

Key words

Chrysosplenium, morphology, new species, phylogeny, taxonomy

Introduction

Chrysosplenium L. is a perennial herbaceous genus of the family Saxifragaceae, consisting of more than 70 species (Kim et al. 2019; Fu et al. 2020). Species of this genus are mainly distributed in temperate regions of the Northern Hemisphere, and their habitats are shady and humid areas in the mountains (Kim and Kim 2015; Kim et al. 2018; Zhao et al. 2022). Biogeographically, Chrysosplenium is known to have originated in East Asia, and several independent lineages have migrated from East Asia to the New World (Soltis et al. 2001; Deng et al. 2015; Liu et al. 2016).

The genus Chrysosplenium is distinguished from other genera in Saxifragaceae by its tetramerous flowers with petaloid sepals and four or eight stamens (Kim et al. 2018). However, species delimitation is often difficult in this genus because of extensive morphological variations owing to differences in growth periods and habitats (Qin et al. 2018; Kim et al. 2019; Choi et al. 2020). The genus is divided into two sections, Chrysosplenium sect. Alternifolia Franch. and C. sect. Oppositifolia Franch., based on the arrangement of the leaves (Franchet 1890). However, Hara (1957) proposed 17 series because of the high variability in the flower, capsule, and seed traits within each section. The infrageneric classification of Chrysosplenium species is based on several criteria, including leaf arrangement, seed surface, pedicel length, sterile branch position, capsule shape, stem surface, ovary position, stamen length, leaf surface, sepal length, and basal leaf size (Hara 1957; Fu et al. 2020). Several phylogenetic studies on Saxifragaceae genera, including Chrysosplenium, have been performed based on the chloroplast matK region, and their results have shown that C. sect. Oppositifolia and C. sect. Alternifolia are monophyletic (Nakazawa et al. 1997; Soltis et al. 2001; Deng et al. 2015). Recently, several new species have been described based on detailed and comprehensive morphological, molecular, and cytological studies (Liu et al. 2016; Kim et al. 2018, 2019; Wakabayashi et al. 2018; Fu et al. 2020, 2021).

Thirteen Chrysosplenium species belonging to seven series have been recognized in the Korean Peninsula to date (Nakazawa et al. 1997; Kim et al. 2019; Choi et al. 2020; Korea National Arboretum 2021). The following are these 13 species [Chrysosplenium ser. Pilosa Maxim.: C. flaviflorum Ohwi, C. epigealum J.W.Han & S.H.Kang, C. ramosissimum Y.I.Kim & Y.D.Kim, C. valdepilosum (Ohwi) S.H.Kang & J.W.Han, C. aureobracteatum Y.I.Kim & Y.D.Kim, C. barbatum Nakai; C. ser. Oppositifolia Maxim.: C. ramosum Maxim.; C. ser. Nepalensia Maxim.: C. grayanum Maxim.; C. ser. Sinica Maxim.: C. sinicum Maxim.; C. ser. Macrostemon H. Hara: C. macrostemon Maxim. ex Franch. & Sav.; C. ser. Alternifolia Maxim.: C. japonicum (Maxim.) Makino, C. serreanum Hand.-Mazz.; C. ser. Flagellifera Maxim.: C. flagelliferum F.Schmidt], and among them, C. aureobracteatum, C. barbatum, C. epigealum, C. flaviflorum, and C. ramosissimum are endemic to Korea (Chung and Kim 1988; Korea National Arboretum 2021; Chung et al. 2023).

During a floristic survey in the southern part of Korea in March 2020, we found a new Chrysosplenium species that is restricted to the southern islands of Korea (Jeju-do and Gageo-do Islands). This species is readily distinguished from previously known Chrysosplenium species in Korea by its greenish-yellow to green bracteal leaves at flowering and a cylindrical papillose seed surface. This species is most similar to C. japonicum (Maxim.) Makino, which belongs to the C. ser. Alternifolia, and is distributed throughout Northeast Asia, including Southeast China, Japan, Korea, Russia (Manchuria), and Taiwan (Nakazawa et al. 1997; Pan and Ohba 2001; Hsu et al. 2011). The new species, however, is clearly distinguishable from C. japonicum by the form of bulbils, color of sepals, number of stamens, and surface of seeds. Based on thorough literature surveys, extensive field observations, detailed analysis of floral morphology and seed coat characteristics, we designated this new species as C. insularis J.E.Jang, K.H.Lee & H.Y.Gil. Here, we provide a detailed morphological description and phylogenetic position of C. insularis and its geographical distribution.

Materials and methods

Material collection

Field surveys were conducted from March 2020 to March 2023. Voucher specimens were deposited at the herbarium of the Korea National Arboretum (KH, http://www.nature.go.kr/kbi/plant/smpl/KBI_2001_030100.do). Materials preserved in 70% ethanol were used to observe and measure the floral parts. Morphological observations and measurements of the new species were conducted on live and dried specimens, including the materials preserved at KH. Quantitative characteristics were measured based on at least 30 samples. The terminology used for description and comparison was referenced from Choi et al. (2020), Pan and Ohba (2001), Lozina (1939), Wakabayashi (2001), Kim et al. (2018), Kim et al. (2019), Fu et al. (2020), Fu et al. (2021).

Microscopic observation

The seed morphology was observed under a stereomicroscope and a scanning electron microscope (SEM). The seeds were measured using a stereomicroscope (Carl Zeiss Microscopy GmbH, Stemi 508, Zeiss, Göttingen, Germany) with an Axiocam ERc 5s. Before SEM imaging, the seeds were dehydrated using 100% ethanol and sputter-coated with gold in a KIC-IA COXEM ion coater (COXEM Co., Ltd., Daejeon, Korea). SEM imaging was performed using a COXEM EM-30 PLUS+ table scanning electron microscope (COXEM) at 20 kV at the Seed Testing Laboratory of KH.

Phylogenetic analysis

Molecular phylogenetic analyses were conducted to confirm the phylogenetic position of the new putative species of Chrysosplenium. Sixteen accessions of four taxa, including the new and related species, were collected from seven localities in South Korea. Total DNA was extracted from silica gel-dried leaves using the DNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA) in accordance with the manufacturer’s instructions. The nrDNA region (ITS) and two cpDNA regions (matK, rbcL) were subjected to polymerase chain reaction (PCR) (Choi et al. 2020) on a ProFlex 96-Well PCR System (Applied Biosystems, Foster City, CA, USA). The primers used and their sequences are listed in Table 1. Each reaction mixture contained AccuPower® PCR PreMix (Bioneer, Daejeon, South Korea), ca. 10 ng (1 μL) of genomic DNA, and 100 pM of primers in a total volume of 20 µL. The PCR conditions included an initial denaturation at 94 °C for 5 min, followed by 35 cycles of amplification at 94 °C for 1 min, 54 °C for 1 min, and 72 °C for 1 min, and a final extension at 72 °C for 7 min. The PCR products were visualized on 1% agarose gels and sequenced on an ABI 3730xl DNA analyzer using the ABI BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). The sequences obtained were manually determined and aligned using MAFFT with Geneious Prime® 2022.1.1. (Biomatters Ltd., Auckland, NZ). The DNA sequences generated in this study have been deposited in GenBank and are indicated with an asterisk (*) in the voucher information in Table 2.

Table 1.
Download as
CSV
XLSX

Primers used for phylogenetic analysis.

Fragment Primer Sequence 5′ → 3′ Reference
ITS ITS1 TCCGTAGGTGAACCTGCGG White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC
rbcL rbcL_1F ATGTCACCACAAACAGAAAC Fay et al. (1998)
rbcL_724R TCGCATGTACCTGCAGTAGC
matK 3F_Kim_F CGTACAGTACTTTTGTGTTTA K.J.Kim, pers. comm.
1R_Kim_R ACCCAGTCCATCTGGAAATCT
Table 2.
Download as
CSV
XLSX

Voucher information and GenBank number of accessions used in this study (*newly generated sequences).

Taxon Locality Voucher information GenBank number
ITS rbcL matK
C. alternifolium JAPAN: Shimane-ken DG2019032310003 OK315466 OK315387 OK315343
C. aureobracteatum KOREA: Gangwon-do, Mt. Gwangdeog LeeJD et al. 17127-1 MK989508 MK989534 MK989559
KOREA: Gangwon-do, Mt. Gwangdeog LeeJD et al. 17127-2 MK989509 MK989533 MK989562
C. barbatum KOREA: Jeollanam-do, Woldeung-myeon LeeJD et al. 17008-1 MK989505 MK989538 MK989560
KOREA: Gyeongsangbuk-do, Mt. Danseok LeeJD et al. 17020-1 MK989506 MK989536 MK989564
KOREA: Gangwon-do, Mt. Gwangdeog LeeJD et al. 17066 MK989507 MK989537 MK989561
C. flagelliferum KOREA: Gyeongsangbuk-do, Ulleung-gun, Gwanmobong ESK21-267* OR809214 PP133187 PP170153
KOREA: Gyeongsangbuk-do, Ulleung-gun, Gwanmobong ESK21-268* OR809215 PP133188 PP170154
KOREA: Gyeongsangbuk-do, Ulleung-gun, Seonginbong AP22-025* OR809213 PP133186 PP170152
KOREA: Gyeoggi-do, Mt. Cheonma LeeJD et al. 17014 MK989499 MK989530 MK989585
KOREA: Gangwon-do, Mt. Cheongtae LeeJD et al. 17052-1 MK989500 MK989529 MK989583
KOREA: Gyeongsangbuk-do, Ulleung-do LeeJD et al. 17122 MK989501 MK989531 MK989584
C. flaviflorum KOREA: Gangwon-do, Mt. Pokkye ESK21-182* OR809216 PP133189 PP170155
KOREA: Gangwon-do, Mt. Pokkye ESK21-183* OR809217 PP133190 PP170156
KOREA: Gangwon-do, Mt. Pokkye ESK21-184-1* OR809218 PP133191 PP170157
KOREA: Gangwon-do, Mt. Pokkye ESK21-184-2* OR809219 PP133192 PP170158
KOREA: Chungcheongbuk-do, Mt. Gyemyeong LeeJD et al. 17030 MK989513 MK989542 MK989569
KOREA: Gyeongsangbuk-do, Mt. Cheonglyang LeeJD et al. 17039 MK989514 MK989540 MK989567
KOREA: Gangwon-do, Mt. Chiak LeeJD et al. 17048 MK989515 MK989541 MK989568
C. grayanum JAPAN: Hokkaido, Sapporo, Mt. Maruyama Nakamura 16401 MK989524 MK989554 MK989574
JAPAN: Hokkaido, Sapporo, Mt. Maruyama Nakamura 16402 MK989523 MK989553 MK989575
JAPAN: Hyogo prefecture, Sasayama Lee JH & JS Shin s. n. MK989525 MK989551 MK989576
KOREA: Jeollanam-do, Mt. Cheongtae LeeJD et al. 17090-1 MK989522 MK989550 MK989579
KOREA: Jeollanam-do, Mt. Cheongtae LeeJD et al. 17090-2 MK989520 MK989555 MK989578
KOREA: Jeollanam-do, Mt. Cheongtae LeeJD et al. 17090-3 MK989521 MK989552 MK989577
C. griffithii CHINA 13PXD035 MH809138 MN185317 MN451058
C. insularis KOREA: Jeju-do, Seogwipo-si, Hogeun-dong SOK-2022-175* OR809225 PP133198 PP170164
KOREA: Jeju-do, Seogwipo-si, Hogeun-dong J.E.Jang et al. 230322* OR809226 PP133199 PP170165
KOREA: Jeollanam-do, Gageodo K.H.Lee 230514-1* OR809227 PP133200 PP170166
KOREA: Jeollanam-do, Gageodo K.H.Lee 230514-2* OR809228 PP133201 PP170167
C. japonicum KOREA: Gyeonggi-do, Mt. Cheonma J.E.Jang 230325-1* OR809220 PP133193 PP170159
KOREA: Gyeonggi-do, Mt. Cheonma J.E.Jang 230325-2* OR809221 PP133194 PP170160
KOREA: Gangwon-do, Wonju-si S.R.Lee et al. 230420-1* OR809222 PP133195 PP170161
KOREA: Gangwon-do, Wonju-si S.R.Lee et al. 230420-2* OR809223 PP133196 PP170162
KOREA: Gangwon-do, Wonju-si S.R.Lee et al. 230420-3* OR809224 PP133197 PP170163
KOREA: Jeollabuk-do, Mt. Chaegye LeeJD et al. 17022 MK989502 MK989548 MK989586
KOREA: Chungcheongnam-do, Palbong-myeon LeeJD et al. 17025-1 MK989504 MK989549 MK989587
C. kamtschaticum JAPAN: Hokkaido, Sapporo, Mt.Maruyama Nakamura 16403 MK989516 MK989539 MK989566
C. ramosum KOREA: Chungcheongbuk-do, Daegang-myeon Goseong LeeJD et al. 17097-1 MK989517 MK989543 MK989571
KOREA: Gangwon-do, Mt. Taegi LeeJD et al. 17147 MK989518 MK989545 MK989573
KOREA: Gyeongsangbuk-do, Mt. Irwol LeeJD et al. 17205-1 MK989519 MK989544 MK989572
C. sinicum KOREA: Jeju-do, Haean-dong LeeJD et al. 17043 MK989528 MK989557 MK989582
KOREA: Gangwon-do, Mt. Cheongtae LeeJD et al. 17051-1 MK989526 MK989556 MK989580
KOREA: Chungcheongbuk-do, Gagok-myeon LeeJD et al. 17086 MK989527 MK989558 MK989581
C. valdepilosum KOREA: Gangwon-do, Mt. Taegi LeeJD et al. 17053-1 MK989512 MK989535 MK989563
KOREA: Jeollabuk-do, Mt. Jiri LeeJD et al. 17057 MK989510 MK989532 MK989565
Peltoboykinia tellimoides JAPAN: Nagano, Kiso-Fukushima, Okuyama 035251 AB248847
CHINA: Zhejiang, Suichang County XXL170002-1 MZ779205

We also included 32 accessions of 13 Chrysosplenium species deposited in GenBank and selected Peltoboykinia tellimoides (Maxim.) Hara as the outgroup (Soltis et al. 1996). A total of 47 accessions from 14 taxa were used for the phylogenetic analysis. Details of the voucher information and GenBank accession numbers of the species used in this study are provided in Table 2. Phylogenetic analyses were performed using the maximum likelihood (ML) method. For the ML analysis, the best-fit model was identified using ModelFinder in Phylosuite (Kalyaanamoorthy et al. 2017; Zhang et al. 2020). ML phylogenies were inferred using IQ-TREE (Nguyen et al. 2015) under the GTR+ F + R3 model in the ITS regions and the TIM+F+R2 model in the combined chloroplast regions (Minh et al. 2013).

Results and discussion

Taxonomic treatment

Chrysosplenium insularis J.E.Jang, K.H.Lee & H.Y.Gil, sp. nov.

urn:lsid:ipni.org:names:77350706-1
Figs 1, 4A–F

Diagnosis

Chrysosplenium insularis differs from C. japonicum in having fairly persistent bulbils, green to yellowish-green sepals, four stamens, and cylindrical papillose seeds.

Type

Korea • Jeju, Seogwipo-si, Hogeun-dong; 33.25084, 126.54434; elev. 58 m; 25 Mar 2020 [fl]; Kang-Hyup Lee JJ-200325-001 [holotype KH (Fig. 2); isotypes, 3 sheets, KH].

Description

Perennial herbs, hermaphroditic, 5–15 cm tall. Bulbils present near stem base, fairly persistent, pink, turning darkish brown, pilose. Roots fibrous, white. Stems erect, cespitose, light green to green, sparsely hairy, without stolons. Basal leaves of flowering stems 1–6, opposite, simple, estipulate; petiole 3–9 cm long, glabrescent or sparsely hairy; blade reniform, 13–20 mm × 15–25 mm, apex rounded and often retuse, margins dentate to crenate, 13–17 teeth, base cordate, adaxially green, pilose, abaxially pale green, subglabrous. Cauline leaves of flowering stems 1–4, alternate, simple, estipulate; petiole 5–22 mm long, glabrescent or sparsely hairy; blade flabellate to reniform, 7–12 mm × 11–18 mm, apex retuse and often rounded or obtuse, margins dentate to crenate, 9–13 teeth, base cordate to broadly cuneate, adaxially green, pilose, abaxially pale green, subglabrous. Inflorescences terminal, 6–14 flowered cyme, surrounded by leaf-like bracts; peduncles 4.59–18.54 mm long; pedicels 0.5–1.5 mm long, sparsely pilose; bracteal leaves by inflorescence 3, petiole 0.2–4.7 mm long, glabrescent or sparsely hairy; blade subflabellate to orbicular, 2–18 × 2–14 mm, apex truncate and often retuse, margins dentate to crenate, 5–9 teeth, base broadly cuneate to subcordate, adaxially green, sparsely pilose to glabrescent, abaxially pale green, subglabrous. Flowers 4-merous, actinomorphic; sepals petaloid 4, free, erect to subspreading, ovate to broadly ovate, 1.2–2.1 × 1.5–3.1 mm, apex obtuse or rounded, yellowish green to green, glabrous; stamens 4; filaments narrow conical, 0.3–0.4 mm long; anther 0.2 mm long, yellow; pistil 2-carpellate, semi-inferior; ovary 1-locular; styles 2, free, erect, 0.2–0.3 mm long; stigma round; disc present. Capsules 2-lobed, horn shaped, lobes subequal, 2.8–3.7 × 3.8–5.2 mm long, green, glabrous, dehiscent along the adaxial suture. Seeds numerous, ovoid-ellipsoid, 0.7–0.9 × 0.5–0.6 mm, brown to dark brown, cylindrical papillose on smooth surfaces.

Figure 1. 

Chrysosplenium insularis A habit B bulbils C stem D basal leaf E inflorescence, F bracteal leaves G flower H, I capsule J seed. Photographs by Ju Eun Jang and Kang-Hyup Lee.

Phenology

Flowering and fruiting from March to May.

Figure 2. 

Holotype of Chrysosplenium insularis.

Distribution and habitat

Southern coastal regions of Korea (Jeju-do and Gageo-do Islands). Forests, wet places in forests, shaded places on the riverside (Fig. 3).

Figure 3. 

Distribution map of Chrysosplenium insularis and C. japonicum in Korea (revised from Oh et al. 2016).

Etymology

The specific epithet “insularis” refers to its distribution on islands.

Vernacular name

Island golden saxifrage: Seom-gwaeng-i-nun (섬괭이눈).

Morphological assessment

Among the species distributed in Korea, Chrysosplenium insularis is morphologically similar to C. japonicum in terms of leaf arrangement, leaf margin, and bracteal leaf color. Despite these similarities, it is clearly differentiated by the form of bulbils [present, fairly persistent (Fig. 1B) vs. present], surface of bracteal leaves [adaxially sparsely pilose to glabrescent, abaxially subglabrous (Fig. 4D) vs. mainly glabrous (Fig. 4J)], color of sepals [green to yellowish green vs. yellowish green to yellow], number of stamens [4 vs. usually 8], and surface of seeds [cylindrical papillose (Fig. 4E, F) vs. papillose (Fig. 4K, L)]. Additionally, this new species is morphologically similar to C. alternifolium, which is distributed in northern Eurasia, but is distinguished by the following characteristics: stolon (absent vs. present), color of bracts (green vs. yellow), color of sepals (green to yellowish green vs. golden yellow), number of stamens (4 vs. 8), and surface of seeds [cylindrical papillose (Fig. 4E, K) vs. smooth (Fig. 4K, L)]. A comparison of the major characteristics of the new species with those of two closely related species, C. japonicum and C. alternifolium, is shown in Table 3.

Figure 4. 

Comparative photographs of the habit (A, G), inflorescence (B, H), bracteal leaves (C, I), surface of bracteal leaves (D, J), and seed (E, F, K, L) of Chrysosplenium insularis (A–F) and C. japonicum (G–L). Photographs by Ju Eun Jang and Kang-Hyup Lee.

Table 3.
Download as
CSV
XLSX

Major characteristics of Chrysosplenium insulalis and two closely related taxa (*: data from Lozina 1939; -: none known).

Character C. insulalis C. japonicum C. alternifolia*
Bulbils present, fairly persistent present -
color pink, turning to darkish brown pink -
Stolon absent absent present
Bracteal leaves color green yellowish green yellow
surfaces adaxially sparsely pilose to glabrescent, abaxially subglabrous mainly glabrous mainly glabrous
Sepals color green to yellowish green yellowish green to yellow golden yellow
Stamens number 4 usually 8 8
Seeds surfaces cylindrical papillose papillose smooth
Fl. and fr. Mar. to May Apr. to Jun. Apr. to Jul.

Phylogenetic analysis

In total, 48 sequences of three regions (ITS, matK, and rbcL) were newly obtained from the 16 accessions of Chrysosplenium insularis and the three related taxa. We also used 93 sequences from 32 accessions obtained from GenBank (12 species of Chrysosplenium and one Peltoboykinia tellimoides as an outgroup) for the phylogenetic analysis. The aligned matrix of the ITS region and combined chloroplast regions (matK and rbcL) contained 635 and 1407 characters, respectively. We found 242 variable sites and 193 parsimony-informative sites in the ITS regions, whereas 172 variable sites and 104 parsimony-informative sites were found in the combined chloroplast regions. The GC ratios were 46.2% and 37.4% for the ITS and combined chloroplast regions, respectively. The phylogenetic tree (Fig. 5) revealed a topology similar to that obtained in a previous study (Choi et al. 2020). The phylogenetic results showed some topological incongruence between the ITS and combined CP trees. In the ITS tree, the most basal clade (BS = 100%) included the monophyletic C. grayanum and C. sinicum and showed a sister relationship with other Chrysosplenium species. However, the CP tree was divided into two clades, with C. grayanum and C. sinicum sharing the most common ancestors with the C. ser. Pilosa, C. kamtschaticum, and C. ramosum (BS = 94%). The phylogenetic relationships among the three subclades were not fully resolved, and the C. ser. Pilosa. was not monophyletic, embedding C. kamtschaticum. Furthermore, the series Alternifolia was monophyletic in the CP tree but not in the ITS tree. Both trees strongly supported the monophyly of C. insularis (BS = 95% in ITS, BS = 96% in CP), and it shared the most common ancestor with C. alternifolium distributed in Japan (BS = 98% in ITS, BS = 77% in CP). The phylogenetic trees revealed that C. insularis formed an independent monophyletic clade from closely related taxa (i.e., C. japonicum and C. alternifolium), suggesting the newly recognized species of Chrysosplenium (Fig. 5).

Figure 5. 

Phylogenetic tree of Chrysosplenium insularis and related taxa based on ITS regions and combined CP regions (matK and rbcL) A ITS region B combined CP regions (matK and rbcL). The numbers above the branches are bootstrap values (BS > 50%) by the maximum likelyhood method. Newly generated sequences in this study are shown with an asterisk, and the new species are marked with a red box. The voucher information of all samples used in the analysis is indicated after the scientific names.

Additional specimens examined

Chrysosplenium insularis (Paratypes): Korea • Jeonnam, Sinan-gun, Heuksan-myeon, Gageodo-ri; 14 May 2023; K.H.Lee 230514-1 (KH). • Jeju, Seogwipo-si, Hogeun-dong; 28 Apr. 2020; PBK0118-001 (KH). • Jeju, Seogwipo-si, Hogeun-dong; 22 Mar. 2022; Hanon-220322-011 (KH) • Jeju, Seogwipo-si, Hogeun-dong; 22 Mar. 2023; J.E.Jang et al. 230322-1 (KH).

Chrysosplenium japonicum: Korea • Gyeonggi, Gwangju-si, Chowol-eup, Mugap-ri, Mugapsan; 24 Apr. 2007; HNHM-A-158 • Gwangju-si, Toechon-myeon, Cheonjinam; 7 Apr. 2000; KNAH014041 • Gwangju-si, Toechon-myeon, Usan-ri, Aengjabong; 11 Apr. 2004; kjs040141 (KH) • Incheon-si, Ongjin-gun, Jawoldo Isl.; 8 Apr. 2009; NAPI-2009-1214 (KH) • Incheon-si, Ongjin-gun, Deokjeok-myeon, Mungap-ri, Gitdaebong; 9 Apr. 2014; Park140230 (KH) • Incheon-si, Ganghwa-gun, Ganghwado Isl.; 20 Apr. 2006; LeeGH6-35 (KH) • Gyeonggi, Namyangju-si, Onam-eup, Cheonmasan; 17 Apr. 2009; ParkSH90273 (KH) • Gyeonggi, Namyangju-si, Onam-eup, Palhyeon-ri; 25 May 2023; J.E.Jang 230325-1 (KH) • Gyeonggi, Namyangju-si, Joan-myeon, Ungilsan; 11 Apr. 2009; Y.M.Kang s.n. (KH) • Gyeonggi, Gwacheon-si, Makgye-dong, Cheonggyesan; 8 Apr. 2006; KHUS20110475 (KH) • Gangwon, Pyeongchang-gun, Yongpyeong-myeon, Jaesan-ri, Geumdangsan; 17 Apr. 2012; JSY120434 (KH) • Jeongseon-gun, Imgye-myeon; 23 Apr. 2011; 0307013 (KH) • Gangwon, Taebaek-si, Hasami-dong, Deokhangsan; 23 Apr. 2005; kjs050052 (KH) • Gangwon, Wonju-si, Panbu-myeon, Geumdae-ri; 20 Apr. 2023; S.R.Lee et al. 230420-1 (KH) • Chungbuk, Danyang-gun, Danyang-eup, Suchon-ri, Sobaeksan; 17 Apr. 2005; Sobaeksan-050417-070 (KH) • Chungbuk, Chungju-si, Sotae-myeon, Boktan-ri; 12 Apr. 2012; Namhan-548 (KH) • Gyeongbuk, Gunui-gun, Bugye-myeon, Dongsan-ri, Palgongsan; 22 Apr. 2006; CBU-070308 (KH) • Gyeongbuk, Bonghwa-gun, Myeongho-myeon, Bugok-ri, Cheongnyangsan; 27 Mar. 2006; CBU-070519 (KH) • Chungbuk, Cheongsong-gun, Hyeonseo-myeon, Bohyeonsan; 22 Apr. 2006; K.O.Yoo s.n. (KH) • Jeonbuk, Namwon-si, Ayeong-myeon, Gusang-ri, Bonghwasan; 1 May 2007; HNHM-A-283 (KH).

Key to the species of Chrysosplenium in South Korea modified from Choi et al. (2020)

1a Cauline leaves alternate 2
2a Leaves heterophyllous; sterile branches developed; caluline and bracteal leaves 2–5 lobed C. flagelliferum
2b Leaves isophyllous; sterile branch absent; cauline and bracteal leaves not lobed with 8–12 teeth 3
3a Sepals green; stamens 4 C. insularis
3b Sepals yellowish green or golden yellow; stamens 8 4
4a Stolons present; sepals golden yellow; seed surface smooth C. alternifolium
4b Stolons absent; sepals yellowish green; seed surface papillose C. japonicum
1b Cauline leaves opposite 5
5a Sepals green, spreading; capsules cup-shaped C. ramosum
5b Sepals yellow, erect; capsules horn-shaped 6
6a Plants glabrous 7
7a Stamens 4 (-6); cylindrical papillae with roundish head at the tip on smooth seed C. grayanum
7b Stamens 8; cylindrical papillae with truncate tip on scabrous seed surfaces 8
8a Sterile branches present; plant glabrous except petiole of sterile branches; stamens shorter than the sepals C. sinicum
8b Sterile branches absent; plant glabrous; stamens longer than the sepals C. macrostemon
6b Plants pubescent 9
9a Seeds without tubercules 10
10a Leaves of sterile branches congested at the distal end, with white variegated veins on the upper surface C. flaviflorum
10b Leaves of sterile branches distantly arranged, with silvery dotted upper surface C. epigealum
9b Seeds with tubercules 11
11a Seed tubercles arranged on inconspicuous longitudinal ridges 12
12a Sterile branches highly branched, ca. 30 cm long after fruiting; leaves of sterile branches with silvery dots, upper surface glabrous; bracteal leaves yellowish-green C. ramosissimum
12b Sterile branches unbranched, less than 15 cm long after fruiting; leaves of sterile branches without silvery dots, upper surface pilose; bracteal leaves bright yellow C. valdepilosum
11b Seed tubercles arranged on prominent longitudinal ridges 13
13a Leaves of sterile branches distantly arranged after fruiting; bracteal leaves golden yellow, greenish yellow at flowering C. aureobracteatum
13b Leaves of sterile branches congested at the distal end after fruiting; bracteal leaves green at flowering C. barbatum

Acknowledgements

We greatly thank Seokmin Yoon and Jin Suk Kim for providing information about this new species and respect their passion for exploring nature.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This study was financially supported by the research projects of the Korea National Arboretum [KNA 1-1-13, 14-1].

Author contributions

Conceptualization: KL. Resources: BKP. Visualization: KL, BKP, and JEJ. Supervision: HG. Writing the original draft: JEJ. Writing, review, and editing: JEJ, KL, HK, and HG.

Author ORCIDs

Ju Eun Jang https://orcid.org/0000-0002-6229-8477

Beom Kyun Park https://orcid.org/0000-0003-1894-3296

Kang-Hyup Lee https://orcid.org/0000-0002-7189-3235

Hyuk-Jin Kim https://orcid.org/0000-0002-3177-2914

Hee-Young Gil https://orcid.org/0000-0003-3714-0827

Data availability

All of the data that support the findings of this study are available in the main text.

References

  • Choi JE, In KH, Kim BS, Kim K, Kim JS, Kim YI, Lee BY, Lim CE (2020) A new distribution record of Chrysosplenium grayanum Maxim.(Saxifragaceae) in Korea: Evidence from morphological and molecular data. Journal of Species Research 9(1): 46–55. https://doi.org/10.12651/JSR.2020.9.1.046
  • Chung YH, Kim YD (1988) Monographic Study of Endemic Plants in Korea X. Taxonomy and Interspecific Relationship of the Genus Chrysosplenium. Korean Journal of Environmental Biology 6(2): 33–63.
  • Deng JB, Drew BT, Mavrodiev EV, Gitzendanner MA, Soltis PS, Soltis DE (2015) Phylogeny, divergence times, and historical biogeography of the angiosperm family Saxifragaceae. Molecular Phylogenetics and Evolution 83: 86–98. https://doi.org/10.1016/j.ympev.2014.11.011
  • Fay MF, Bayer C, Alverson WS, de Bruijn AY, Chase MW (1998) Plastid rbcL sequence data indicate a close affinity between Diegodendron and Bixa. Taxon 47(1): 43–50. https://doi.org/10.2307/1224017
  • Franchet AR (1890) Monographie du genere Chrysosplenium Tourn. Nouvelles Archives du Muséum d’Histoire Naturelle, Série 3 2: 87–114.
  • Hara H (1957) Synopsis of genus Chrysosplenium L. Journal of the Faculty of Science, University of Tokyo, Section III. Botany 7: 1–90.
  • Hsu TC, Chung SW, Cheng YC (2011) Chrysosplenium japonicum (Saxifragaceae), Newly Recorded from Taiwan. Taiwania 56(4): 337–340.
  • Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: fast model selection for accurate phylogenetic estimates. Nature methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285
  • Kim YI, Kim YD (2015) Chrysosplenium aureobracteatum (Saxifragaceae), a new species from South Korea. Novon: A Journal for Botanical Nomenclature 23(4): 432–436. https://doi.org/10.3417/2013018
  • Korea National Arboretum (2021) Checklist of Vascular Plants in Korea (Native Plants). Korea National Arboretum, 1006 pp.
  • Lozina AS (1939) Chrysosplenium L. In: Komarov VL, Yuzepchuk SV (Eds) Flora of the U. S.S.R, Vol. 9. Botanical Institute of Academy of Science, Leningrad, 156–158.
  • Minh BQ, Nguyen MA, von Haeseler A (2013) Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution 30(5): 1188–1195. https://doi.org/10.1093/molbev/mst024
  • Nakazawa M, Wakabayashi M, Ono M, Murata J (1997) Molecular phylogenetic analysis of Chrysosplenium (Saxifragaceae) in Japan. Journal of Plant Research 110(2): 265–274. https://doi.org/10.1007/BF02509315
  • Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Oh BU, Ko SC, Kang SH, Paik WK, Yoo KO, Im HT, Jang CG, Chung GY, Choi BH, Choi HJ, Lee YM, Shin CH, Choi K, Han JS, Park SH, Kim HJ, Chang KS, Yang JC, Jung SY, Lee CH, Oh SH, Jo DG (2016) Distribution Maps of Vascular Plants in Korea. Korea National Arboretum, Pocheon, 216 pp.
  • Pan JT, Ohba H (2001) Chrysosplenium. In: Wu ZY, Raven PH (Eds) Flora of China, Vol. 8. Science Press, Beijing, and Missouri Botanical Garden Press, St. Louis, 346–358.
  • Qin R, Lan DQ, Huang W, Liu H (2018) Research progress on chemical constituents and pharmacological activities of Chrysosplenium spp.(Saxifragaceae). Journal of South-Central University for Nationalities 37: 54–59. [Natural Science Edition]
  • Soltis DE, Nakazawa MT, Xiang QY, Kawano S, Murata J, Wakabayashi M, Jetter CH (2001) Phylogenetic relationships and evolution in Chrysosplenium (Saxifragaceae) based on matK sequence data. American Journal of Botany 88(5): 883–893. https://doi.org/10.2307/2657040
  • Wakabayashi M (2001) Chrysosplenium L. In: Iwatsuki K, Boufford DE, Ohba H (Eds) Flora of Japan, Vol. IIb. Kodansha Ltd., Tokyo, 58–70.
  • Wakabayashi M, Takahashi H, Tomita S (2018) Chrysosplenium suzukaense (Saxifragaceae), a New Species from Yoro and Suzuka Mts., Central Honshu, Japan. Acta Phytotaxonomica et Geobotanica 69(1): 41–51.
  • White TJ, Bruns TD, Lee SB, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR protocols: a guide to methods and applications. Academic Press, San Diego, California, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1
  • Zhang D, Gao F, Jakovlić I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular ecology resources 20(1): 348–355. https://doi.org/10.1111/1755-0998.13096
  • Zhao J, Qiu X, Zhao Y, Wu R, Wei P, Tao C, Wan L (2022) A review of the genus Chrysosplenium as a traditional Tibetan medicine and its preparations. Journal of Ethnopharmacology 290: 115042. https://doi.org/10.1016/j.jep.2022.115042
login to comment