Research Article
Print
Research Article
Gastrochilus balangshanensis (Orchidaceae, Aeridinae), a new subalpine epiphytic orchid from the Mountains of Southwest China
expand article infoJun-Yi Zhang‡§, Yue-Hong Cheng|, Min Liao‡, Sen-Long Jin|, Hong-Qiang Lin|, Pan-Yan Yang|, Hai He, Bo Xu§‡
‡ Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, China
§ University of Chinese Academy of Sciences, Beijing, China
| Wolong National Natural Reserve Administration Bureau, Wenchuan, China
¶ Chongqing Normal University, Chongqing, China

Corresponding author: Hai He ( hehai@cqnu.edu.cn )

Corresponding author: Bo Xu ( xubo@cib.ac.cn )

Academic editor: João Farminhão
© 2024 Jun-Yi Zhang, Yue-Hong Cheng, Min Liao, Sen-Long Jin, Hong-Qiang Lin, Pan-Yan Yang, Hai He, Bo Xu.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Zhang J-Y, Cheng Y-H, Liao M, Jin S-L, Lin H-Q, Yang P-Y, He H, Xu B (2024) Gastrochilus balangshanensis (Orchidaceae, Aeridinae), a new subalpine epiphytic orchid from the Mountains of Southwest China. PhytoKeys 247: 123-135. https://doi.org/10.3897/phytokeys.247.130755
Open Access

Abstract

Gastrochilus balangshanensis, a new orchid species from the Balang Mountain, Sichuan Province, Southwest China, is described and illustrated. It morphologically resembles G. affinis, but differs in having shorter stems, a reniform epichile and a sub-hemispherical hypochile (spur), obtuse-rounded at the apex. The results of molecular phylogenetic analyses based on nuclear ribosome internal transcribed spacer (nrITS) and four chloroplast DNA markers (matK, psbA–trnH, psbM–trnD and trnL–F) from 50 Gastrochilus species indicate that G. balangshanensis is closely related to G. heminii and G. bernhardtianus, also endemic to the Hengduan Mountains. The novelty is a branch and trunk epiphyte in mixed coniferous forest.

Key words

Hengduan Mountains, new species, phylogeny, Sichuan, Vandeae

Introduction

Gastrochilus D.Don (Don 1825) is a vandoid genus of epiphytic orchids, within subtribe Aeridinae, consisting of 79 species, widely distributed in Tropical and Subtropical Asia (Tsi 1996; Tsi 1999; Liu et al. 2019; Govaerts et al. 2021; Zhou et al. 2021; Zhang et al. 2022; Ya et al. 2023; Zhang et al. 2024). It is characterized by the enlarged and saccate hypochile, forming a spur, and two subglobose pollinia borne on a slender stipe (Pridgeon et al. 2014; Liao et al. 2022). Recently, based on molecular and morphological data, a new infrageneric classification of Gastrochilus has been proposed by Zhang et al. (2024), dividing the genus into six sections, viz. G. sects. Acinacifolii Q.Liu & J.Y.Gao ex Jun Y.Zhang & H.He, Brachycaules Q.Liu & J.Y.Gao ex Jun Y.Zhang & H. He, Caespitosi Z.H.Tsi, Gastrochilus, Microphylli (Benth. & Hook.f.) Seidenf. and Pseudodistichi Jun Y.Zhang & H.He. More than 20 new species of Gastrochilus were described in the past five years, greatly enriching the diversity of this genus (Liu et al. 2019; Rao et al. 2019; Wu et al. 2019; Chen et al. 2022; Dey et al. 2022; Liao et al. 2022; Nguyen et al. 2022; Zhang et al. 2022; Lee et al. 2023; Liu et al. 2023; Ya et al. 2023; Zhang et al. 2024; Zhou et al. 2024).

In April 2023, during a survey of orchid diversity in the subalpine forests of the Balang Mountain in Sichuan Province, Southwest China, some flowering specimens of Gastrochilus were collected. They were tentatively ascribed to the section Microphylli, which is characterized by the closely alternate leaves and a smooth-glabrous epichile (Zhang et al. 2024). After detailed morphological examination, the material could not be assigned to any recognized species of G. sect. Microphylli. Our phylogenetic analyses, combining the nuclear ribosome internal transcribed spacer (nrITS) with four plastid markers of 49 congeneric taxa, also support its recognition as a new species, which we describe here.

Materials and methods

Morphological analyses

Herbarium specimens and silica-gel dried leaves of the novelty were collected in the field in the Balang Mountain, Wenchuan County, Sichuan Province, Southwest China. The measurements and description of the novelty were based on four field-collected living plants and three dried herbarium specimens (Jun-Yi Zhang & Yue-Hong Cheng ZJY185; Jun-Yi Zhang & Yue-Hong Cheng ZJY186; Jun-Yi Zhang & Yue-Hong Cheng ZJY204). The taxonomic description follows the terminology used by Beentje (2016). Voucher specimens and additional silica-gel dried leaves are deposited in CDBI Herbarium (acronym following Thiers 2021, continuously updated). Additionally, we examined the scans of six specimens of three closely related taxa, including relevant type specimens (see taxonomic treatment for details), deposited at CDBI, K, PE and KUN.

DNA extraction, amplification and sequencing

The sequences of the 56 species included in the molecular phylogenetic analysis, originally published in Liu et al. (2019) and Zhang et al. (2024), were retrieved from GenBank, except those obtained from two individuals of the new species, which were newly generated in this study. Detailed information concerning the DNA markers, sampled taxa, voucher collections and GenBank accession numbers are listed in Appendix 1: Tables A1, A2. Total DNA was extracted exclusively from silica-gel dried leaves via a Plant DNA Isolation Kit (Cat.No.DE-06111). Based on the phylogenetic studies of Gastrochilus by Liu et al. (2019) and Zhang et al. (2024), we applied the same primers to amplify its nuclear ribosome internal transcribed spacer (nrITS) and four chloroplast DNA fragments (matK, psbA–trnH, psbM–trnD, and trnL–F) through polymerase chain reaction (PCR). All DNA samples were sent to TSINGKE Biotech Co. Ltd (Chengdu, China) for sequencing. The final manually corrected sequences were then submitted to GenBank (Appendix 1: Table A2).

Phylogenetic analyses

All sequences were edited via Sequencher v4.1.4 (Gene Codes, Ann Arbor, Michigan, USA) and aligned via MAFFT v7.475 (Katoh and Standley 2013) with default parameters. We performed phylogenetic analyses based on the datasets of combined nuclear ribosome internal transcribed spacer (nrITS) and the four chloroplast DNA fragments, after checking for congruence. A total of 56 taxa were included in the analysis of the combined datasets, with one species of Luisia Gaudich., one species of Saccolabium Blume, two species of Holcoglossum Schltr. and two species of Pomatocalpa Breda used as the outgroups based on Liu et al. (2019) and Zhang et al. (2024). The nucleotide substitution model for the data matrix was estimated using jModeltest v2.1.6 (Posada 2008) and the evolutionary best fit model (GTR+F+I+G4) was selected using the corrected Akaike Information Criterion (AICc). Maximum likelihood (ML) and Bayesian inference (BI) methods were employed for phylogenetic tree reconstruction. The ML analysis was performed using IQ-TREE v1.4.2 (Nguyen et al. 2014) with branch support estimated using 2,000 replicates. The BI analysis was conducted using MrBayes v3.2.7a (Ronquist and Huelsenbeck 2003) with two separate Markov chain Monte Carlo (MCMC) chains (20,000,000 generations and sampled every 1,000 generations). The first 25% of the trees were discarded as burn-in, and the remaining trees were used to generate a majority-rule consensus tree. The resulted phylogenetic trees were visualized using Chiplot (Xie et al. 2023).

Results

Phylogenetic reconstruction

The aligned nrITS matrix is 687 nucleotides long with 188 variable sites, and the combined four plastid markers matrix included 3,458 nucleotides in length with 185 variable sites, consists of 805 bp for matK, 677 bp for psbA–trnH, 945 bp for psbM–trnD, and 1031 bp for trnL–F, respectively. The attributes of the five plastid markers are summarized in Appendix 1: Table A1. Both ML and BI analyses of the combined nrITS and four plastid markers matrix produced similar topologies (Fig. 1). The 50 taxa of Gastrochilus form a well-supported monophyletic group (BI/ML = 1/97, Fig. 1), which was subdivided into six well-supported section-specific clades (G. sects. Gastrochilus, Pseudodistichi, Brachycaules, Acinacifolii, Microphylli). The new species is resolved as distinct within section G. sect. Microphylli. The two accessions of G. balangshanensis were resolved as sisters to each other (BI/ML = 1/100, Fig. 1), clustering successively with G. bernhardtianus J.D.Ya & D.Z.Li and G. heminii M.Liao, B.Xu & Yue H.Cheng (Fig. 2; BI/ML = 0.98/88%).

Figure 1. 

Maximum Likelihood phylogenetic tree of Gastrochilus, including 50 taxa, based on the combined nrITS and four-plastid (matK, psbA–trnH, psbM–trnD, and trnL–F) marker dataset. Values before slash indicate Bayesian posterior probabilities and numbers after slash indicate ML bootstrap supports for major lineages. An asterisk (*) indicates that a node is not supported in the analysis. The two accessions of the inferred new species are highlighted in red, and colors of terminal nodes correspond to the six sections of Gastrochilus defined in Zhang et al. (2024).

Morphological comparison among G. balangshanensis, G. heminii, G. bernhardtianus and G. affinis is summarized in Table 1, further supporting the recognition of Gastrochilus balangshanensis sp. nov.

Table 1.
Download as
CSV
XLSX

Morphological comparison of Gastrochilus balangshanensis with three related species of G. sect. Microphylli.

Character G. balangshanensis G. heminii G. affinis G. bernhardtianus
Stem length 1.5–3.5 cm 3.0–6.5 cm 3.0–12.0 cm ca. 5.0 cm
Leaf shape nearly elliptic narrowly oblong or oblong-falcate oblong-lanceolate to subspathulate oblong-lanceolate
No. of flowers per inflorescence 1 or 2 1 or 2 1–4 1 or 2
Peduncle length 0.8–1.2 cm 0.4–0.7 cm 1.5–2.0 cm ca. 0.3 cm
Dorsal sepal elliptic, ca. 5.6–6.4 × 4.8–5.2 mm, apex obtuse elliptic-oblong, ca. 2.4 × 1.5 mm, apex obtuse elliptic-oblong, 3.0–5 .0 × 1.0–1.3 mm, apex obtuse elliptic, ca. 5.2 × 3.4 mm, apex obtuse
Lateral sepals oblong, 5.0–5.8 × 4.0–4.4 mm, apex obtuse narrowly oblong, 2.6 × 1.3 mm, apex obtuse elliptic-ovate, 3.5–4.0 × 0.7–1.3 mm, apex obtuse narrowly ovate, 5.5 × 2.8 mm, apex obtuse
Petals oblong, 5.0–5.8 × 4.0–4.4 mm, apex obtuse narrowly oblong, ca. 2.6 × 1.3 mm, apex obtuse ovate-elliptic to elliptic, 3.0–4.0 × 1.0–1.3 mm, apex obtuse narrowly oblong, ca. 5.2 × 2.7 mm, apex obtuse
Epichile (lip lamina) reniform, 10.0–12.0 × 5.5–6.5 mm, central thickened purple-red mat with two inconspicuous ridges reniform, 4.2–6.5 × 2.0–3.0 mm, central thickened purple-red mat with irregular folds subtriangular, ca. 8.0 × 4.5 mm, central thickened purple-red mat with 2 median ridges from base to apex transversely oblong, ca. 8.0 × 2.8 mm, central thickened yellow-green mat with 2 conic calli near its base
Hypochile (lip spur) sub-hemispherical, 6.0–8.0 × 5.8–7.5 mm, dorsally compressed, obtuse-rounded at the apex subconical or helmet-shaped, ca. 2.0–2.4 × 1.6–2.0 mm, dorsally compressed, splits into two conical sacs at the apex obconical, 3.0–4.0 × 2.0–3.0 mm, dorsally compressed, shortly bifid at the apex subconical, ca. 5.1 × 3.8 mm, dorsally compressed splits into two conical sacs at the apex

Taxonomic treatment

Gastrochilus balangshanensis Jun Y.Zhang, B.Xu & Yue H.Cheng, sp. nov.

urn:lsid:ipni.org:names:77349954-1
Figs 2A, B, 3

Type

China • Sichuan: Wenchuan, Balangshan, Yinchangou, mixed coniferous forest, on tree branches, elev. ca. 2,260 m, in flower, 19 April 2023, Jun-Yi Zhang & Yue-Hong Cheng ZJY185 (holotype: CDBI!; isotype: KUN!).

Figure 2. 

Habitat and habit of Gastrochilus balangshanensis in situ A habitat B–D flowering plants of G. balangshanensis growing on tree trunks or branches E, F fruiting plants of G. balangshanensis. Photograph credits: A–E Yue-Hong Cheng F Jun-Yi Zhang.

Diagnosis

Gastrochilus balangshanensis is most similar to G. affinis, but can be distinguished by its shorter stem (1.5–3.5 vs. 3.0–12.0 cm), nearly elliptic leaves (vs. oblong-lanceolate to subspathulate), larger sepals (5.6–6.4 × 4.8–5.2 vs. 3.0–5.0 × 1.0–1.3 mm) and petals (5.0–5.8 × 4.0–4.4 vs. 3.0–4.0 × 1.0–1.3 mm), reniform epichile (vs. subtriangular) and sub-hemispherical hypochile, obtuse-rounded at the apex (vs. hypochile obconical, subacute to obtuse and shortly bifid at apex).

Figure 3. 

Gastrochilus balangshanensis A habit B leaf, abaxial view C raceme, front view D raceme, lateral view E flowers, front view F flowers, abaxial view G1 dorsal sepal G2, 3 petals G4, 5 lateral sepals G6 labellum H anther cap, ventral view I pollinarium with pollinia.

Description

Epiphytic herb, monopodial, pendent, 1.5–3.5 cm tall. Roots vermiform, 4.0–6.0 cm long, ca. 1.6 mm in diameter. Stem unbranched, 0.5–2.5 cm long, ca. 1.5 mm in diameter. Leaves closely alternate, nearly elliptic, 0.9–1.5 × 0.4–0.8 cm, apex acute and with 1–2 lobules, lobes setaceous, with purplish-red spots. Inflorescence a raceme with 1 or 2 flowers; peduncle curved upward and thickened, 5.0–8.0 mm long, proximally covered with one sheath; floral bracts ovate-lanceolate, 0.8–1.2 cm long, apex acute. Flowers spreading, ca. 1.0 × 1.4 cm, pedicel and ovary connate, 6.0–9.0 mm long, sepals and petals heterochromatic on both surfaces, yellow-green with purplish-red spots on the outer side, purplish-red with yellow-green margin on the inner side. Dorsal and lateral sepals similar and equal in size, elliptic, 5.6–6.4 × 4.8–5.2 mm, apex obtuse. Petals oblong, 5.0–5.8 × 4.0–4.4 mm, apex acute, base narrowed. Labellum with a reniform epichile, revolute, white with purplish-red spots, 10.0–12.0 × 5.5–6.5 mm, margin erose, smooth and glabrous above, central thickened purple-red mat with two inconspicuous ridges; hypochile sub-hemispherical, yellowish-green with purplish-red spots, 6.0–8.0 × 5.8–7.5 mm, dorsally compressed, obtuse-rounded at the apex. Column cylindrical, ca. 1.5 mm long; viscidium yellow, ca. 0.7 × 0.4 mm; stipe white, ca. 1.1 mm long; anther cap purplish-red, ca. 1.5 × 1.3 mm, rostellum bilobed, lobes acuminate at the apex; pollinia 2, ca. 0.5 × 0.4 mm, yellow, subglobular, porate; stigma deeply sunken, inverted V-shaped, ca. 0.7 mm long, yellow. Capsule ellipsoid, 12.0–15.0 × 8.0–10.0 mm, green with sparse purplish-red spots, prominently 6-ribbed.

Distribution and habitat

Gastrochilus balangshanensis is currently known only from Yinchanggou, Balang Mountain, Wenchuan County, Sichuan Province, Southwest China, part of the Hengduan Mountains (Fig. 4). It is epiphytic on tree trunks or branches in subalpine mixed coniferous forest dominated by Abies fargesii var. faxoniana (Rehder & E.H.Wilson) T.S.Liu, at an elevational range between 2200–2300 m, co-occurring with two terrestrial orchids, Goodyera recurva Lindl. and Calanthe arcuata Rolfe.

Figure 4. 

Distribution map of Gastrochilus balangshanensis and four related species of G. sect. Microphylli.

Phenology

Flowering from March to April, during the dry season, fruiting from May to September.

Etymology

Its specific epithet refers to the Balang Mountain, type locality of this new orchid. A Chinese name, “ba lang shan peng ju lan” (巴朗山盆距兰), is suggested here.

Additional specimens examined

China • Sichuan: Wenchuan, Balangshan, Yinchangou, mixed coniferous forest, on tree trunk, elev. ca. 2300 m, in flower, 19 April 2023, Jun-Yi Zhang & Yue-Hong Cheng ZJY186 (CDBI!); ibid. loc., mixed coniferous forest, on tree branch, elev. ca. 2315 m, in fruit, 22 July 2024, Jun-Yi Zhang & Yue-Hong Cheng ZJY204 (CDBI!).

Examined specimens of Gastrochilus affinis

India • Arunachal Pradesh: Lachong Valley, elev. ca. 2438 m, in flower, July 1897, R. Pantling 444 (lectotype K). China • Xizang: Chayu, under forest, elev. ca. 2685 m, in flower, 24 August 2009, Southeast Tibet Expedition Team SET-ET 717 (PE); China • Yunnan: Fugong, Jiakedi, east slope of Gaoligongshan, epiphytic on trunk, elev. ca. 2555 m, in flower, 16 May 2005, X. H. Jin6984 (PE).

Examined specimens of Gastrochilus bernhardtianus

China • Yunnan: Lijiang Prefecture, Yulong County, Yunshanping, elev. ca. 3308 m, in cold-temperate, evergreen conifer forest, in flower, 20 May 2020, J.-D. Ya et al. 20CS19022 (holotype KUN).

Examined specimens of Gastrochilus heminii

China • Sichuan: Wenchuan, Wolong, mixed coniferous forest, on tree trunk, elev. ca. 2640 m, in flower and fruit, 15 March 2022, Min Liao & Yue-Hong Cheng ZJY143 (holotype CDBI!); Wenchuan County, Wolong, mixed coniferous forest, on tree trunk, elev. ca. 2640 m, in flower, 14 April 2022, Min Liao, Jun-Yi Zhang & Yue-Hong Cheng ZJY167 (CDBI!).

Discussion

The Hengduan Mountains (HDM) is part of the Tibeto-Himalayan region (THR), which possesses an exceptionally diverse flora (~12,800 seed plant species are recognized, Sun et al. 2017). We have previously discovered some new species of Gastrochilus in Wenchuan County, such as G. wolongensis Jun Y.Zhang, B.Xu & Yue H.Cheng (Zhang et al. 2022), G. heminii M.Liao, B.Xu & Yue H.Cheng (Liao et al. 2022), G. armeniacus Jun Y.Zhang, B.Xu & Yue H.Cheng (Zhang et al. 2024) and G. minjiangensis Jun Y.Zhang, B.Xu & Yue H.Cheng (Zhang et al. 2024). The discovery of Gastrochilus balangshanensis reinforces the need for more in-depth botanical exploration in this region.

Based on a series of morphological characteristics, including leaf shape, leaf size and color markings, Gastrochilus balangshanensis is most similar to G. bernhardtianus and G. heminii. However, based on overall floral characters, namely color, G. balangshanensis is most similar to G. affinis. This is possibly explained by parallel evolution.

Our phylogenetic analysis retrieved Gastrochilus balangshanensis in a clade with G. bernhardtianus and G. heminii, both also endemic to the HDM. This supports the recognition of an overlooked center of endemism, possibly associated with rapid allopatric speciation in close mountain ranges within G. sect. Microphylli, which now numbers 11 species.

Acknowledgements

We would like to thank the staff of CDBI, K, KUN and PE for their kind assistance in facilitating the access to herbarium specimens.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

Our work was funded by the Sichuan Science and Technology Program (Grant No. 2024NSFSC1325), the Biological Resources Program, Chinese Academy of Sciences (BRP CAS) (KFJ-BRP-017-102), the 2024 subsidy funds for field rescue and artificial breeding of rare and endangered species, the Wild Plants Sharing and Service Platform of Sichuan Province, and the 2024 central government's forest and grass transfer payment for national park subsidies.

Author contributions

JYZ, YHC, ML, SLJ, HQL, PYY, HH and BX discovered and identified the species. YHC, SLJ, HQL and PYY assisted in extensive field investigation and samples collection. JYZ and ML performed the experiments and analyzed the data. JYZ wrote the manuscript. ML, HH and BX revised the manuscript. All authors read and approved the final manuscript.

Author ORCIDs

Jun-Yi Zhang https://orcid.org/0000-0001-8325-5954

Yue-Hong Cheng https://orcid.org/0000-0001-6263-0989

Min Liao https://orcid.org/0000-0001-6777-8579

Sen-Long Jin https://orcid.org/0000-0003-0200-4710

Hong-Qiang Lin https://orcid.org/0000-0001-8152-4911

Pan-Yan Yang https://orcid.org/0009-0004-0722-8953

Hai He https://orcid.org/0000-0001-5362-9177

Bo Xu https://orcid.org/0000-0003-3507-9321

Data availability

All of the data that support the findings of this study are available in the main text.

References

  • Beentje H (2016) The Kew plant glossary: an illustrated dictionary of plant terms, 2nd edn. Kew Publishing, Kew, 184 pp.
  • Chen WS, Lei M, Ma CB, Jin XH, Wang XL (2022) Gastrochilus xizangensis (Aeridinae, Vandeae, Orchidaceae), a new species from Xizang, China. Phytotaxa 566(2): 219–226. https://doi.org/10.11646/phytotaxa.566.2.6
  • Don D (1825) Prodromus Florae Nepalensis. J. Gale, London, 256 pp.
  • Govaerts R, Campacci MA, Baptista DH, Baptista PJ, George A, Kreutz K, Wood JJ (2021) World Checklist of Orchidaceae. The Board of Trustees of the Royal Botanic Gardens, Kew. http://www.kew.org/wcsp/monocots/ [Accessed 13 August 2021]
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010
  • Liao M, Cheng YH, Zhang JY, Feng Y, Liu GY, Ye P, Jin SL, Lin HQ, Xu B (2022) Gastrochilus heminii (Orchidaceae, Epidendroideae), a new species from Sichuan, China, based on molecular and morphological data. PhytoKeys 215: 95–106. https://doi.org/10.3897/phytokeys.215.91061
  • Liu Q, Song Y, Jin XH, Gao JY (2019) Phylogenetic relationships of Gastrochilus (Orchidaceae) based on nuclear and plastid DNA data. Botanical Journal of the Linnean Society 189(3): 228–243. https://doi.org/10.1093/botlinnean/boy084
  • Nguyen LT, Schmidt HA, Von-Haeseler A, Minh BQ (2014) IQ-TREE: A fast and effective stochastic algorithm for estimating Maximum-Likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Nguyen VC, Averyanov LV, Maisak TV, Nguyen TLT, Nguyen VK, Truong BV (2022) Gastrochilus pankajkumarii, (Aeridinae, Epidendroideae, Orchidaceae) a new lithophytic orchid from southern Vietnam. Taiwania 67: 35–39. https://doi.org/10.6165/tai.2022.67.35
  • Pridgeon AM, Cribb PJ, Chase MW, Rasmussen FN (2014) Genera orchidacearum: Epidendroideae, volume 6, Part 3. Oxford University Press, Oxford, 544 pp.
  • Rao WH, Liu ZJ, Zhang GQ, Chen XH, Huang J, Chen GZ, Chen LJ (2019) A new epiphytic species of Gastrochilus (Orchidaceae: Epidendroideae) from Yunnan, China. Phytotaxa 413(4): 296–300. https://doi.org/10.11646/phytotaxa.413.4.5
  • Sang T, Crawford D, Stuessy T (1997) Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84(8): 1120–1120. https://doi.org/10.2307/2446155
  • Sun Y, Skinner D, Liang G, Hulbert SH (1994) Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics 89(1): 26–32. https://doi.org/10.1007/BF00226978
  • Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17(5): 1105–1109. https://doi.org/10.1007/BF00037152
  • Thiers B (2021) Index Herbariorum: a global directory of public herbaria and associated staff. New York Botanical Garden’s Virtual Herbarium. http://sweetgum.nybg.org/science/ih
  • Thiv M, Stuwe L, Kadereit JW (1999) The phylogenetic relationships and evolution of the Canarian laurel forest endemic Ixanthus viscosus (Aiton) Griseb. (Gentianaceae): Evidence from matK and ITS sequences, and floral morphology and anatomy. Plant Systematics and Evolution 218(3–4): 299–317. https://doi.org/10.1007/BF01089233
  • Tsi ZH (1996) A preliminary revision of Gastrochilus (Orchidaceae). Guihaia 16: 123–154.
  • Tsi ZH (1999) Gastrochilus D. Don. In: Tsi ZH (Ed.) Flora Reipublicae Popularis Sinicae, Vol. 19. Science Press, Beijing, 399–420.
  • Wu XF, Ye DP, Pan B, Lin XQ, Jiang H, Liu Q (2019) Validation of Gastrochilus prionophyllus (Vandeae, Orchidaceae), a new species from Yunnan Province, China. PhytoKeys 130: 161–169. https://doi.org/10.3897/phytokeys.130.34555
  • Xie JM, Chen YR, Cai GJ, Cai RL, Hu Z, Wang H (2023) Tree visualization by one Table (tvBOT): A web application for visualizing, modifying and annotating phylogenetic trees. Nucleic Acids Research 51(W1): W587–W592. https://doi.org/10.1093/nar/gkad359
  • Ya JD, Wang WT, Liu YL, Jiang H, Han ZD, Zhang T, Huang H, Cai J, Li DZ (2023) Five new and noteworthy species of Epidendroideae (Orchidaceae) from southwestern China based on morphological and phylogenetic evidence. PhytoKeys 235: 211–236. https://doi.org/10.3897/phytokeys.235.111230
  • Zhang JY, Cheng YH, Liao M, Jin SL, Qu CM, Tan YC, Plenković-Moraj A, Xu B (2022) Gastrochilus wolongensis (Orchidaceae): A new species from Sichuan, China, based on molecular and morphological data. Ecosystem Health and Sustainability 8(1): 2101546. https://doi.org/10.1080/20964129.2022.2101546
  • Zhang JY, Cheng YH, Liao M, Feng Y, Jin SL, He TM, He H, Xu B (2024) A new infrageneric classification of Gastrochilus (Orchidaceae: Epidendroideae) based on molecular and morphological data. Plant Diversity 46(4): 435–447. https://doi.org/10.1016/j.pld.2023.08.001
  • Zhou CY, Zeng MY, Wu YW, Li MH (2024) Gastrochilus pseudodresslerii (Orchidaceae; Vandeae), a new species from China: evidence from morphological and DNA analysis. Phytotaxa 634: 071–078. https://doi.org/10.11646/phytotaxa.634.1.6

1Jun-Yi Zhang and Yue-Hong Cheng contributed equally to this work.

Appendix 1

Table A1.
Download as
CSV
XLSX

Information on the DNA markers used in phylogenetic reconstruction of Gastrochilus.

Marker Length (bp) Variable sites (bp) Primer Sequence (5’to3’) Origin
nrITS 687 188 GGAAGGAGAAGTCGTAACAAGG Thiv et al. 1999
CTTTTCCTCCGCTTATTGATATG Thiv et al. 1999
psbA–trnH 677 37 GTTATGCATGAACGTAATGCTC Sang et al. 1997
CGCGCATGGTGGATTCACAAATC Sang et al. 1997
matK 805 28 CGATCTATTCATTCAATATTTC Sun et al. 1994
TCTAGCACACGAAAGTCGA Sun et al. 1994
psbM–trnD 945 65 GCGGTAGGAACTAGAATAAATAG Zuo et al. 2011
GGGATTGTAGTTCAATTGGT Zuo et al. 2011
trnL-F 1031 55 CGAAATCGGTAGACGCTACG Taberlet et al. 1991
ATITGAACTGGTGACACGAG Taberlet et al. 1991
Table A2.
Download as
CSV
XLSX

Voucher information and GenBank accession numbers of DNA sequences of Gastrochilus used in phylogenetic inference.

Taxa Voucher Location nrITS matK psbA–trnH trnL–F psbM–trnD
G. acaulis (Lindl.) Kuntze — — KM583455 KM583465 — — —
G. acinacifolius Z.H.Tsi Z. J. Liu 3316 CHINA KJ733412 KJ733569 KJ733492 KJ733649 —
G. acinacifolius Z.H.Tsi Q. Liu 62 CHINA: Hainan (Baomeiling) MK357118 MK357138 MK357160 MK357208 MK357216
G. acinacifolius Z.H.Tsi ZJY289 CHINA: Yunnan (Malipo) OQ566796 OQ575562 OQ575590 OQ575530 OQ575619
G. acutifolius (Lindl.) Kuntze Q. Liu 05 CHINA: Yunnan (Jingmai) — MK357140 MK357162 — MK357230
G. acutifolius (Lindl.) Kuntze JK-DEBCR-mat-31(JK) — MW475270 MW433889 — — —
G. affinis (King & Pantl.) Schltr. Q. Liu 97 CHINA: Yunnan (Fugong) — MK357141 MK357163 — MK357141
G. alatus X.H.Jin & S.C.Chen Q. Liu 98 CHINA: Yunnan (Bingzhongluo) — — — — MK357228
G. alatus X.H.Jin & S.C.Chen ZJY297 CHINA: Yunnan — OQ575563 OQ575591 OQ575531 OQ575620
G. armeniacus Jun Y.Zhang, B.Xu & Yue H.Cheng ZJY244 CHINA: Sichuan (Wenchuan) OP348889 OP373113 OP373119 OP373128 OP373123
G. armeniacus Jun Y.Zhang, B.Xu & Yue H.Cheng ZJY285 CHINA: Sichuan (Wenchuan) OP348888 OP373114 OP373118 OP373127 OP373124
G. balangshanensis Jun Y.Zhang, B.Xu & Yue H.Cheng ZJY317 CHINA: Sichuan (Wenchuan) PP960151 PP944493 PP944495 PP944499 PP944497
G. balangshanensis Jun Y.Zhang, B.Xu & Yue H.Cheng ZJY318 CHINA: Sichuan (Wenchuan) PP960152 PP944494 PP944496 PP944500 PP944498
G. bellinus (Rolfe. F.) Kuntze Q. Liu 52 CHINA: Yunnan (Lancang) KY966597 KY966884 — — —
G. bellinus (Rolfe. F.) Kuntze Q. Liu 53 CHINA: Yunnan (Mengsong) MK357123 MK357142 MK357164 MK357202 MK357241
G. bellinus (Rolfe. F.) Kuntze ZJY279 CHINA: Yunnan (Mengla) OQ566799 OQ575564 OQ575592 OQ575534 OQ575621
G. bernhardtianus J.D.Ya & D.Z.Li 20CS19022 CHINA: Yunnan (Lijiang) OR073404 20CS19022 20CS19022 20CS19022 20CS19022
G. bernhardtianus J.D.Ya & D.Z.Li 20CS19023 CHINA: Yunnan (Lijiang) OR073405 20CS19023 20CS19023 20CS19023 20CS19023
G. bigibbus (Rchb. f. ex Hook. f.) Kuntze Li 009 — — MN124439 MN124439 MN124439 MN124439
G. calceolaris D.Don Z. J. Liu 3769 CHINA KF545874 KF545885 KF545865 — KF545896
G. calceolaris D.Don Q. Liu 94 CHINA: Yunnan (Jingdong) MK357126 MK357144 MK357169 MK357205 MK357233
G. calceolaris D.Don ZJY281 CHINA: Yunnan (Malipo) — OQ575565 OQ575593 OQ575535 OQ575622
G. changjiangensis Q.Liu & M.Z.Huang Q. Liu 45 CHINA: Hainan (Changjiang) MK357124 — MK357166 — MK357236
G. ciliaris F.Maekawa Q. Liu 88 CHINA: Nursery of Management Office of Yushan Scenic Area, Fuzhou — MK357148 MK357173 — MK357225
G. ciliaris F.Maekawa ZJY299 CHINA: Taiwan — OQ575566 OQ575594 — OQ575623
G. dasypogon (Lindl.) Kuntze Q. Liu 30 CHINA: Hainan (Baomeiling) MK357129 MK357149 MK357181 MK357197 MK357219
G. deminutus J.M.H.Shaw — — KY966600 KY966887 — — —
G. distichus (Lindl.) Kuntze Z. J. Liu 4755 CHINA KJ733414 KJ733571 KJ733494 KJ733651 —
G. distichus (Lindl.) Kuntze ZJY309 CHINA: Yunnan (Malipo) OQ566800 OQ575567 OQ575595 OQ575536 —
G. fargesii (Kraenzl.) Schltr. 20HT3548 CHINA: Chongqing OR073405 S18942 S18942 S18942 S18942
G. formosanus (Hayata) Hayata Z. J. Liu 4256 CHINA KJ733416 KJ733573 KJ733495 KJ733653 —
G. formosanus (Hayata) Hayata Q. Liu 91 CHINA: Yunnan (Gongshan) — — MK357174 — MK357226
G. formosanus (Hayata) Hayata ZJY276 CHINA: Hubei (Enshi) OQ566801 OQ575568 OQ575596 OQ575537 OQ575624
G. fuscopunctatus (Hayata) Hayata Q. Liu 86 CHINA: Taiwan (Hualian) — MK357150 MK357171 MK357192 MK357231
G. fuscopunctatus (Hayata) Hayata* — — — KX871233 KX871233 KX871233 KX871233
G. gongshanensis Z.H.Tsi ZJY295 CHINA: Yunnan (Malipo) — OQ575569 OQ575597 OQ575538 OQ575625
G. guangtungensis Z.H.Tsi Z. J. Liu 4127 CHINA KJ733417 KJ733574 KJ733496 KJ733654 —
G. guangtungensis Z.H.Tsi ZJY293 CHINA: Yunnan OQ566802 OQ575570 OQ575598 OQ575539 OQ575626
G. heminii M.Liao, B.Xu & Yue.H.Cheng ZJY241 CHINA: Sichuan (Wenchuan) ON286752 ON331126 ON331128 ON331130 ON331132
G. heminii M.Liao, B.Xu & Yue.H.Cheng ZJY283 CHINA: Sichuan (Wenchuan) ON286753 ON331127 ON331129 ON331131 ON331133
G. intermedius (Griff. ex Lindl.) Kuntze Q. Liu 38 CHINA: Yunnan (Yinchang) MK357121 MK357151 MK357172 MK357190 MK357213
G. japonicus (Makino) Schltr. Q. Liu 87 CHINA: Taiwan (Pingdong) KF545875 KF545886 KF545866 KF545897 —
G. japonicus (Makino) Schltr. — — — KX871236 KX871236 KX871236 KX871236
G. kadooriei Kumar et al. ZJY268 CHINA: Yunnan (Malipo) OQ566803 OQ575571 OQ575599 OQ575540 OQ575627
G. lihengiae J.D.Ya, H.Jiang & D.Z.Li 22CS21828 CHINA: Yunnan (Gongshan) OR073408 S18742 S18742 S18742 S18742
G. lihengiae J.D.Ya, H.Jiang & D.Z.Li 23CS24145 CHINA: Yunnan (Gongshan) OR073408 S18895 S18895 S18895 S18895
G. linearifolius Z.H.Tsi & Garay Q. Liu 711 MYANMA: Hkakaborazi National Park MK357133 MK357136 MK357187 MK357194 MK357229
G. linii Ormerod Q. Liu 92 CHINA: Nursery of Management Office of Yushan Scenic Area, Fuzhou — MK357152 MK357176 MK357198 MK357224
G. malipoensis X.H.Jin & S.C.Chen Q. Liu 71 CHINA: Yunnan (Nanwenghe) — MK357147 MK357177 MK357200 MK357235
G. malipoensis X.H.Jin & S.C.Chen ZJY288 CHINA: Yunnan (Malipo) OQ566804 OQ575572 OQ575600 OQ575541 OQ575628
G. matsuran (Makino) Schltr. — — KT338700 — — — —
G. minjiangensis Jun Y.Zhang, B.Xu & Yue H.Cheng ZJY243 CHINA: Sichuan (Wenchuan) OP348887 OP373112 OP373117 OP373126 OP373122
G. minjiangensis Jun Y.Zhang, B.Xu & Yue H.Cheng ZJY284 CHINA: Sichuan (Wenchuan) OQ566806 — — OQ575542 —
G. minutiflorus Aver. Q. Liu 37 CHINA: Yunnan (Malipo) — MK357153 MK357179 — MK357215
G. minutiflorus Aver. ZJY287 CHINA: Yunnan (Malipo) OQ566807 OQ575573 OQ575601 OQ575544 OQ575629
G. nanchuanensis Z.H.Tsi ZJY296 CHINA: Chongqing (Nanchuan) OQ566808 OQ575574 OQ575602 OQ575545 OQ575630
G. obliquus var. obliquus (Lindl.) Kuntze Q. Liu 708 MYANMA: Hponkanrazi Wildlife Sanctuary MK357131 MK357137 KJ733498 KJ733656 MK357211
G. obliquus var. obliquus (Lindl.) Kuntze Q. Liu 44 CHINA: Yunnan (Yinchang) MK357130 MK357154 MK357182 MK357195 MK357218
G. suavis Seidenf. ZJY277 CHINA: Yunnan OQ566809 OQ575575 OQ575603 OQ575546 OQ575631
G. suavis Seidenf. ZJY282 CHINA: Yunnan (Maguan) OQ566810 OQ575576 OQ575604 OQ575547 OQ575632
G. platycalcaratus (Rolfe) Schltr. Q. Liu 19 CHINA: Yunnan (Yinchang) MK357122 — MK357175 — MK357222
G. platycalcaratus (Rolfe) Schltr. ZJY300 CHINA: Yunnan (Mengla) OQ566811 — OQ575605 OQ575548 OQ575633
G. prionophyllus H.Jiang, D.P.Ye & Q.Liu ZJY291 CHINA: Yunnan OQ566812 OQ575577 OQ575606 OQ575549 OQ575634
G. pseudodistichus (King & Pantl.) Schltr. ZJY308 CHINA: Yunnan (Malipo) OQ566813 OQ575578 OQ575607 OQ575550 OQ575635
G. pseudodistichus (King & Pantl.) Schltr. ZJY290 CHINA: Yunnan (Maguan) OQ566814 OQ575579 OQ575608 OQ575551 OQ575636
G. rantabunensis S.Chow ex T.P.Lin Q. Liu 89 CHINA: Taiwan (Taipei) — MK357155 MK357184 MK357193 MK357223
G. rantabunensis S.Chow ex T.P.Lin ZJY303 CHINA: Taiwan OQ566815 OQ575580 OQ575609 OQ575552 OQ575637
G. raraensis Fukuy. Z. J. Liu 4798 CHINA KJ733420 KJ733577 KJ733499 KJ733657 —
G. setosus Aver. & Vuong ZJY304 Vietnam OQ566816 OQ575581 OQ575610 OQ575553 —
G. sinensis Z.H.Tsi ZJY228 CHINA: Zhejiang (Hangzhou) OM985813 OK042953 OK172399 OK172401 OQ575646
G. sinensis Z.H.Tsi S1109 CHINA: Sichuan (Wenchuan) OP348890 OP373115 OP373120 OP373129 OP373125
G. somai (Hayata) Hayata Q. Liu 36 CHINA: Fujian (Pingnan) MK357128 — MK357180 — MK357220
G. somai (Hayata) Hayata Li 073 — — MN124436 MN124436 MN124436 MN124436
G. sororius Schltr. — — ERR7622420 ERR7622420 ERR7622420 ERR7622420
G. wenshanensis Q.Liu, D.P.Ye & X.H.Jin ZJY292 CHINA: Yunnan (Maguan) OQ566820 OQ575586 OQ575615 OQ575558 OQ575642
G. sumartranus J.J.Sm. ZJY280 Vietnam OQ566818 OQ575583 OQ575612 OQ575555 OQ575639
G. sumartranus J.J.Sm. ZJY294 Vietnam OQ566819 OQ575584 OQ575613 OQ575556 OQ575640
G. tianbaoensis Q.Liu & Y.H.Tan ZJY275 CHINA: Yunnan (Malipo) — OQ575585 OQ575614 OQ575557 OQ575641
G. tianbaoensis Q.Liu & Y.H.Tan Q. Liu 63 CHINA: Yunnan (Malipo) MK357120 MK357157 MK357186 MK357207 MK357214
G. wolongensis Jun Y.Zhang, B.Xu & Yue H.Cheng ZJY240 CHINA: Sichuan (Wenchuan) OM985810 OK172400 OK172402 OK172404 OK172403
G. wolongensis Jun Y.Zhang, B.Xu & Yue H.Cheng S1108 CHINA: Sichuan (Wenchuan) OM985811 OM974209 OM974211 OM974210 OQ575647
G. xuanenensis Z.H.Tsi ZJY298 CHINA: Guizhou — OQ575587 OQ575616 OQ575559 OQ575643
G. yunlongensis W.H.Rao, L.J.Chen & Z.J.Liu ZJY301 CHINA: Yunnan — OQ575588 OQ575617 OQ575560 OQ575644
G. yunnanensis Schltr. Q. Liu 60 CHINA: Yunnan (Mengsong) MK165469 MK357158 MK357185 — MK357212
G. yunnanensis Schltr. ZJY278 CHINA: Yunnan OQ566821 OQ575589 OQ575618 OQ575561 OQ575645
G. zhenyuanensis Q.Liu & D.P.Ye Q. Liu 61 CHINA: Yunnan (Zhenyuan) MK357127 MK357146 MK357168 MK357199 MK357237
Holcoglossum amesianum (Rchb. F.) Christenson X.H. Jin 004/006 CHINA HQ404389 JF763779 HQ404439 — —
H. kimballianum (Rchb. F.) Garay X.H. Jin 017 CHINA HQ452901 JF763787 HQ404452 — —
Luisia magniflora Z.H.Tsi et S.C.Chen Z. J. Liu 3444 CHINA KJ733426 KJ733583 KJ733505 — —
Pomatocalpa diffusum Breda TBG145837 INDONESIA AB217576 AB217752 — EF670432 —
P. spicatum Breda Z. J. Liu 4589 CHINA KJ733438 KJ733595 KJ733518 KJ733675 —
Saccolabium pusillum Blume TBG144220 INDIA AB217580 AB217756 — — —
login to comment