Research Article
Print
Research Article
Thrixspermum taeniophyllum (Orchidaceae, Epidendroideae), a new species from southwest China, based on molecular and morphological evidence
expand article infoJun-Yi Zhang‡§, Yue-Hong Cheng|, Min Liao§, Gui-Ying Liu|, Pan-Yan Yang|, Bo Xu§, Hai He‡
‡ Chongqing Normal University, Chongqing, China
§ Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, China
| Wolong National Nature Reserve Administration Bureau, Wenchuan, China
¶ University of Chinese Academy of Sciences, Beijing, China

Corresponding author: Bo Xu ( xubo@cib.ac.cn )

Corresponding author: Hai He ( hehaicq@gmail.com )

Academic editor: Murielle Simo-Droissart
© 2023 Jun-Yi Zhang, Yue-Hong Cheng, Min Liao, Gui-Ying Liu, Pan-Yan Yang, Bo Xu, Hai He.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Zhang J-Y, Cheng Y-H, Liao M, Liu G-Y, Yang P-Y, Xu B, He H (2023) Thrixspermum taeniophyllum (Orchidaceae, Epidendroideae), a new species from southwest China, based on molecular and morphological evidence. PhytoKeys 230: 145-156. https://doi.org/10.3897/phytokeys.230.104273
Open Access

Abstract

Thrixspermum taeniophyllum is described as a new orchid species from Wenchuan County, Sichuan Province of southwest China. It is morphologically similar to T. japonicum, but it differs from the latter in having branched stems, slightly fleshy strap-shaped leaves, longer inflorescences with 3–6 flowers and a capitate gynandrium with a lip-shaped mouth opening. Its species status is also supported by molecular phylogenetic analyses, based on nuclear ribosome internal transcribed spacer (nrITS) and three chloroplast DNA fragments (matK, psbA-trnH and trnL-F), which showed distinct systematic boundaries from the most morphologically similar T. japonicum and their morphological relatives T. saruwatarii and T. pygmaeum.

Key words

Epiphytic orchid, flora of Sichuan, phylogeny, systematic position, taxonomy

Introduction

Thrixspermum Lour. (1790) is a genus of mostly medium-sized epiphytes and lithophytes in the family Orchidaceae Juss. and it is known to include ca. 160 species widely distributed from tropical and subtropical Asia to the islands of the western Pacific islands (Chen et al. 2009; Chase et al. 2015; Kumar et al. 2017). This genus is characterised by the persistent floral bracts, a three-lobed labellum and the four waxy subglobose pollinia grouped into two unequal masses in appearance (Loureiro 1790; Chen et al. 2009). It is also a congregation of elusive orchids with limited floral materials for morphological comparison due to their rather short flowering period (Govaerts et al. 2016). From accounts of ca. 17 species distributed in southern China, only one species, T. japonicum (Miq.) Reichenbach fils (1878), has been recorded from Sichuan Province (Song et al. 2009; Kumar et al. 2017; Zhou et al. 2021).

As part of a continuous inventory of orchids from Sichuan, China, we have conducted continuous field explorations in the Wenchuan section of the Giant Panda National Park. During a field trip in March 2022, we encountered an interesting epiphytic orchid in Wolong National Nature Reserve (Wenchuan County, Sichuan Province, China), that we had initially identified it as Thrixspermum japonicum, based on its pendulous inflorescence, golden-yellow flowers and orange-red striped lateral lobes of the labellum. However, upon a critical morphological observation and comparison with available specimens including the type materials of two of the three [we were unsuccessful to trace the type specimen(s) of T. pygmaeum (King & Pantl.) Holttum (1960)] morphologically related species (Fig. 1A–I), for example, T. japonicum (P. F. V. Siebold, s.n., L) and T. saruwatarii (Hayata) Schlechter (1919) (T01201, TI), we assumed it to be a new species of Thrixspermum that we are now describing hereafter.

Figure 1. 

Comparison of four species of Thrixspermum. Living plant of T. taeniophyllum (A), T. japonicum (B), T. saruwatarii (C) and T. pygmaeum (D); Detailed colour photos of T. japonicum (E: a habit b leaves c inflorescence d, e flower in front and back view f1 dorsal sepal f2–3 petals f4–5 sepals f6, h labellum g gynandrium and ovary i anther cap); Type specimens of T. taeniophyllum (F: holotype at CDBI), T. japonicum (G: holotype at L) and T. saruwatarii (H: holotype at TI); and a representative specimen of T. pygmaeum (I: TI). [Images A and E photographed by Min Liao; image B photographed by Yue-Hong Cheng; image C cited from website (https://kevinyu589.blogspot.com/) image D cited from website (https://www.gbif.org/species/2846707); the image of the type specimen of T. japonicum was obtained from JSTOR and those of T. saruwatarii and T. pygmaeum were cited from available from Plants of Taiwan (https://tai2.ntu.edu.tw/search/2)].

Materials and methods

Morphological observations

Morphological information (including the colour, size and shape of the roots, stems, leaves, flowers and floral parts, details see Table 1) of this new species was obtained from observations and measurements of eight living plants in the field and four dried herbarium specimens (voucher information: Jun-Yi Zhang, Min Liao & Yue-Hong Cheng ZJY144; Jun-Yi Zhang & Yue-Hong Cheng ZJY189; Jun-Yi Zhang & Yue-Hong Cheng ZJY191; Jun-Yi Zhang & Yue-Hong Cheng ZJY192) deposited at CDBI (acronym of herbarium follows Thiers 2023). Voucher information for the four specimens used for morphological observations and their collection location are detailed in the taxonomic treatment. The terminology in Beentje (2012) was followed for the description.

Table 1.
Download as
CSV
XLSX

Morphological comparison amongst Thrixspermum taeniophyllum, T. japonicum, T. saruwatarii and T. pygmaeum. Characters of the last three species are modified from the respective protologues (Miquel 1866; King and Pantling 1898; Hayata 1916) and Flora of China (Chen et al. 2009).

Character T. taeniophyllum T. japonicum T. saruwatarii T. pygmaeum
Stems 4–8 cm long, often branched, internodes 5–8 mm 3–13 cm long, unbranched, internodes 3–5 mm shorter than 2 cm, unbranched, internodes ≤ 1 mm shorter than 3 cm, unbranched, internodes ≤ 1 mm
Leaves dichotomously alternate, slightly fleshy, strap-shaped, 5–7 × 0.5–1 cm dichotomously alternate, thinly leathery, oblong, 2–4 × 0.5–0.7 cm nearly basal, narrowly oblong or linear-oblanceolate, 4–8 × 0.5–2 cm nearly basal, elliptic to linear-oblong, rarely falcate, 2–8 × 0.7–1.5 cm
Inflorescences 6–12 cm long, with 3–6 flowers 3–5 cm long, with 2–3 flowers longer than 8 cm, with 1–4 flowers 2–4 cm long, with 2–4 flowers
Floral bracts broadly ovate-triangular, ca. 4 mm broadly ovate-triangular, ca. 2.5 mm ovate-triangular, 2–3 mm ovate, 2–3 mm
Dorsal sepal elliptic, 5–7 × 3.5–4.5 mm oblong, 5–7 × 2.5–3 mm oblong, 7–8 × 3–5 mm elliptic, 6–8 × 4–5 mm
Lateral sepals elliptic, 5–7 × 3.5–4.5 mm ovate-lanceolate, 5–7 × 2.5–3 mm slightly oblique, 7–8 × 3–5 mm obliquely ovate, 6–7 × 4–5 mm
Petals narrowly elliptic, 4.5–6 × 2–3 mm narrowly oblong, 5–6 × 1.5–2 mm linear, falcate, 5–6 × ca. 2 mm oblong-spatulate, 6–7 × 2–3 mm
Lateral lobes of labellum erect, nearly oblong, ca. 2.5 mm narrowly ovate-oblong, ca. 2.5 mm erect, falcate, ca. 3 mm erect, oblong, falcate, 6–7 mm
Mid-lobe of labellum fleshy, very small, teeth triangular fleshy, very small, semi-orbicular fleshy, very small, triangular fleshy, small, semi-orbicular
Lip disc without a callus, slightly depressed, with red purple or golden yellow hairs with a callus, slightly depressed, densely tomentose with a callus, where a tuft of brownish-yellowish hairs arises without a callus, slightly depressed, with a tuft of purple hairs
Gynandrium Capitate, mouth opening lip-shaped conical, mouth opening triangular cylindrical, mouth opening semi-lunar cylindrical, mouth opening semi-lunar

DNA extraction and sequencing

The sequences of four individuals of this new species from two different areas (Wolong and Gengda towns) in Wenchuan County and two individuals of T. japonicum (vouchers Jun-Yi Zhang & Yue-Hong Cheng ZJY187 and Jun-Yi Zhang & Yue-Hong Cheng ZJY188, deposited at CDBI) were newly obtained in this study with the following protocols. Total DNA was extracted from silica-gel dried leaves via a Plant DNA Isolation Kit (Cat.No.DE-06111, Foregene, Chengdu, China). The sequences were amplified by means of the primers (Table 2) used in previous studies of Thrixspermum (Li et al. 2014; Zou et al. 2015). The PCR programme consisted of an initial 4 min preheating stage at 98 °C, followed by 35 cycles of 30 s at 98 °C (denaturation), 30 s at 48–56 °C (annealing) and 60–100 s at 68 °C (extension), followed by a final 8 min extension at 68 °C. The PCR products were sent to TSINGKE Biotech (Chengdu, China) for sequencing. The returned sequences were edited via Sequencher v.4.1.4 (Gene Codes, Ann Arbor, Michigan, USA) and checked manually and then deposited in the GenBank with the following accession numbers: nrITS (OP348891, OQ608783, OR054231, OR054232, OR054229, OR054230), matK (OP373116, OQ626557, OR062235, OR062236, OR062233, OR062234), psbA-trnH (OP373121, OQ626556, OR062240, OR062241, OR062238, OR062239) and trnL-F (OR184926, OR184927, OR062245, OR062246, OR062243, OR062244), respectively.

Table 2.
Download as
CSV
XLSX

Information of DNA markers used in this study for Thrixspermum.

DNA markers Length (bp) Variable sites (bp) Primer sequence (5’to3’) Origin
nrITS 675 239 ACGAATTCATGGTCCGGTGAAGTGTTCG Sun et al. (1994)
GAATTCCCCGGTTCGCTCGCCGTTAC Sun et al. (1994)
psbA-trnH 748 44 GTTATGCATGAACGTAATGCTC Sang et al. (1997)
CGCGCATGGTGGATTCACAAATC Sang et al. (1997)
matK 881 122 CGATCTATTCATTCAATATTTC Sun et al. (1994)
TCTAGCACACGAAAGTCGA Sun et al. (1994)
trnL-F 908 94 AAAATCGTGAGGGTTCAAGTC Sang et al. (1997)
GATTTGAACTGGTGACACGAG Sang et al. (1997)

Phylogenetic analyses

A total of 54 accessions representing 44 taxa were incorporated in the phylogenetic analysis, including Phalaenopsis marriottiana (Rchb. f.) Kocyan & Schuiteman (2014) as outgroup. The ingroup includes 36 entities of Thrixspermum representing 26 species and 17 taxa belonging to six related genera in Aeridinae (Orchidaceae, Epidendroideae) following the two previous studies of Li et al. (2014) and Zou et al. (2015). The detailed information concerning the sampled taxa, voucher specimens and GenBank accession numbers (including the sequences retrieved from GenBank) used for the phylogenetic analyses are summarised in Appendix 1. The nrITS, matK, psbA-trnH and trnL-F matrices contain 40, 22, 13 and 13 taxa, respectively (Appendix 1). All sequences were aligned using MAFFT v.7.475 (Katoh and Standley 2013) with default parameters. The incongruence length difference test (ILD) was used to quantify the conflicts between nuclear DNA (nrITS) and plastid DNA (matK, psbA-trnH, trnL-F) data in PAUP v.4.0a169 (Darlu and Lecointre 2002; Swofford 2002). The ILD Test (P = 0.11) indicated that nrITS and plastid datasets were suitable for combined analysis in Thrixspermum and, thus, the results are based on the combined data of nrITS and three plastid markers. The nucleotide substitution models for these data matrices were estimated using the software jModelTest v.2.1.6 (Posada 2008) and the best fit models were selected using the corrected Akaike Information Criterion (AICc). Bayesian Inference (BI) and Maximum Likelihood (ML) analyses were performed to infer the phylogenetic relationships within the combined dataset. The BI analysis was conducted using MrBayes v.3.2.7a (Ronquist and Huelsenbeck 2003), with two separate Markov Chain Monte Carlo (MCMC) chains (1,000,000 generations and sampled every 1,000 generations). The first 25% of the trees were discarded as burn-in and the remaining trees were used to generate a majority-rule consensus tree. The ML analysis was performed using IQ-TREE v.1.4.2 (Nguyen et al. 2014) with branch support estimated using 2,000 replicates of both SH-like approximate likelihood-ratio test (SH-aLRT) (Guindon et al. 2010) and the ultrafast bootstrapping algorithm (UFboot) (Minh et al. 2013).

Results

The aligned nrITS matrix of 48 accessions (40 taxa) was 675 nucleotides in length with 239 variable sites and plastid matrix of 30 accessions (23 taxa) was 2537 nucleotides in length with 260 variable sites, of which 881 bp for matK (29 accessions, 22 taxa, 122 variable sites), 748 bp for psbA-trnH (20 accessions, 13 taxa, 44 variable sites) and 908 bp for trnL-F (19 accessions, 13 taxa, 94 variable sites), respectively (Table 2). Phylogenetic analyses indicated that the 26 included taxa of Thrixspermum formed a well-supported monophyletic group (Fig. 2). Four individuals of the inferred new species from the two sites in Wenchuan County were resolved as a strongly-supported monophyletic lineage (Fig. 2; BI/ML = 1/100%), which further clustered with T. japonicum, T. saruwatarii and T. pygmaeum into a subclade (Fig. 2; BI/ML = 1/100%). These four species also showed certain morphological similarities (referring to Fig. 1 and Table 1). It is noted that T. japonicum is the most related species to the novelty by sharing with the new species pendulous inflorescence, inside brownish-striped lateral lobes and densely hairy small triangular mid-lobe of labellum (Fig. 1B, E). Besides, the following morphological diagnosis, their molecular boundary is clearly shown by the positions of their respective individuals as well (Fig. 2).

Figure 2. 

Maximum Likelihood tree of 36 entities of Thrixspermum reconstructed, based on combined nuclear and plastid dataset. Numbers before slash indicate Bayesian posterior probabilities and numbers after slash indicate ML bootstrap supports for major lineages. Asterisk (*) indicates that a node is not supported in the analysis. The four individuals of the inferred new species are highlighted in red.

Taxonomic treatment

Thrixspermum taeniophyllum Jun Y.Zhang, H.He & Yue H.Cheng, sp. nov.

urn:lsid:ipni.org:names:77324993-1
Figs 1A, 3

Type

China. Sichuan Province, Wenchuan County, Wolong Town, in coniferous and broadleaf mixed forest, on tree trunks, elev. ca. 1762 m, in flower, 30 March 2022, Jun-Yi Zhang, Min Liao & Yue-Hong Cheng ZJY144 (holotype CDBI!).

Figure 3. 

Thrixspermum taeniophyllum A flowering plant B leaves C inflorescence D part of the rachis showing persistent bracts E flower in front view F dissection of a flower (F1: dorsal sepal; F2–F3: petals; F4–F5: sepals; F6: labellum) G, H labellum I pollinia J gynandrium and ovary.

Diagnosis

It is most similar to Thrixspermum japonicum in morphology, but it differs from the latter by its often-branched stems (vs. unbranched stems), slightly fleshy strap-shaped leaves 5–7 cm long (vs. thinly leathery oblong leaves 2–4 cm long), longer inflorescences with 3–6 flowers (vs. shorter inflorescences with 2–3 flowers) and its capitate gynandrium with a lip-shaped mouth opening (vs. conical gynandrium with a triangular mouth opening). It also resembles T. saruwatarii and T. pygmaeum and morphological comparison amongst the four species is visualised in Fig. 1 and summarised in Table 1.

Description

Epiphytic on tree trunks. Roots vermiform and slender. Stems ascending or pendulous especially when in flowering, 4–8 cm long, ca. 1.5 mm thick, often branched, internodes 5–8 mm apart. Leaves green, dichotomously alternate, slightly fleshy, strap-shaped, 5–7 × 0.5–1 cm, apex acute and bifid with two unequally mucronate tips. Inflorescence arising from basal stem laterally or opposite to leaves, usually pendulous, 6–12 cm long; rachis slightly flexuous and slightly thickened distally, 4–6 cm long, laxly 3–6 flowered; bracts spirally arranged, obliquely patent, ca. 3 mm long, broadly ovate-triangular, apex acute. Flowers initially white and later turning creamy yellow, blossoming almost simultaneously; dorsal and lateral sepals similar, elliptic, 5–7 × 3.5–4.5 mm, apex obtuse, with obscure 3 veins; petals narrowly elliptic, smaller than sepals, 4.5–6 × 2–3 mm, apex obtuse, with obscure 1 or 2 veins; labellum small, three-lobed, base shallowly saccate; lateral lobes erect, triangularly oblong, ca. 2.5 mm, apex rounded or ± notched, inner surface with many purplish-red stripes; mid-lobe fleshy, reddish-brown, very small, apex ended with triangular teeth; disc concave, inside base densely covered with red purple or golden yellow hairs; gynandrium capitate, with a lip-shaped mouth opening; ca. 2.5 mm high; column foot ca. 1.2 mm, with one joint at the junction with the labellum; pollinia 4 grouped into two nearly similar masses, ca. 0.8 × 0.7 mm, yellow, full and obovately spherical. Fruits unseen.

Distribution and habitat

Thrixspermum taeniophyllum was found in Wenchuan County, Sichuan Province, southwest China. It is epiphytic on trees in coniferous and broadleaf mixed forest at an elevational range between 1260 and 1770 m.

Phenology

Flowering in March and April.

Etymology

The specific epithet taeniophyllum is a compound adjective referring to the shape of leaves of this new species. A Chinese name, dai ye bai dian lan (带叶白点兰), is also suggested, based on the its leaf feature.

Additional specimens examined

China. Sichuan Province, Wenchuan County, Wolong Town, evergreen broad-leaved forest, on tree trunks, elev. ca. 1769 m, in flower, 1 May 2023, Jun-Yi Zhang & Yue-Hong Cheng ZJY189 (CDBI!); Sichuan Province, Wenchuan County, Gengda Town, evergreen broad-leaved forest, on tree trunks, elev. ca. 1508 m, in flower, 2 May 2023, Jun-Yi Zhang & Yue-Hong Cheng ZJY191 (CDBI!); Sichuan Province, Wenchuan County, Gengda Town, evergreen broad-leaved forest, on tree trunks, elev. ca. 1520 m, in flower, 2 May 2023, Jun-Yi Zhang & Yue-Hong Cheng ZJY192 (CDBI!).

Examined specimens of Thrixspermum japonicum

Japan. P. F. V. Siebold, s.n. (holotype L; It is not clear whether duplicates exist); China. Sichuan, Emeishan, elev. ca. 990 m, 12 July 1980, K. Y. Lang, B. C. Gao et al. 044 (PE); Baoxing, elev. ca. 1800 m, 2 April 1983, D. Y. Peng 47469 (CDBI!); Beichuan, elev. ca. 1640 m, 1 August 1984, C. L. Tang et al. 284 (CDBI!). Chongqing: Nanchuan, elev. ca. 900 m, 2 November 1983, Z. Y. Liu 4669 (IMC); Nanchuan, elev. ca. 850 m, 30 May 1984, Z. Y. Liu 5219 (PE).

Examined specimens of Thrixspermum saruwatarii

China. Taiwan, Alishan, 8 April 1916, B. Hayata, s.n. (holotype TI); Kaohsiung, 20 October 1934, S. Sasaki, s.n. (TAI). Yunnan, Gongshan, elev. ca. 1702 m, 20 May 2007, X. H. Jin 9001 (PE). Hunan, Ningyuan, elev. ca. 340 m, 8 May 2011, X. L. Yu 11050801 (CSFI). Guangdong, Dapu, elev. ca. 700 m, 9 June 1957, L. Deng 4953 (IBSC).

Examined specimens of Thrixspermum pygmaeum

China. Taiwan, Taipingshan, 3 April 1940, Y. Kobayashi, s.n. (TI); Taitung, 22 March 1932, S. Sasaki, s.n. (TAI); Miaoli, 13 November 1972, C. C. Hsu 12600 (TAI); Ilan, 10 March 2013, C. C. Hsu, s.n. (TAI).

1a Stems shorter than 3 cm, internodes ≤ 1 mm; leaves nearly basal 2
2a Inflorescences longer than 8 cm; lip disc with a callus, where a tuft of brownish-yellowish hairs arises T. saruwatarii
2b Inflorescences 2–4 cm long; lip disc without a callus, slightly depressed, with a tuft of purple hairs T. pygmaeum
1b Stems longer than 3 cm, internodes ≥ 3 mm; leaves distichous alternate 3
3a Stems branched; leaves strap-shaped, 5–7 × 0.5–1 cm; inflorescences 6–12 cm long with 3–6 flowers and a capitate gynandrium with a lip-shaped mouth opening T. taeniophyllum
3b Stems unbranched; leaves oblong, 2–4 × 0.5–0.7 cm; inflorescences 3–5 cm long with 2–3 flowers and a conical gynandrium with a triangular mouth opening T. japonicum

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statement

No ethical statement was reported.

Funding

This study was supported by the Second Tibetan Plateau Scientific Expedition and Research (STEP) programme (Grant Nos. 2019QZKK0301 & 2019QZKK0502), the National Key Research and Development Programme of China (Grant No. 2020YFE0203200), 2022 Central Finance Forestry Grassland Ecological Protection and Restoration National Park Subsidy Project, 2022–2023 Subsidy Projects of Prohibited Developmental Areas from the Transfer Payment of the National Key Ecological Functional Areas and Wild Plants Sharing and Service Platform of Sichuan Province.

Author contributions

JYZ, YHC, ML, GYL, PYY, HH and BX discovered and identified the species. YHC, GYL, and PYY assisted in extensive field investigation and samples collection. JYZ and ML performed the experiments and analyzed the data. JYZ wrote the manuscript. ML, HH and BX revised the manuscript. All authors read and approved last manuscript.

Author ORCIDs

Jun-Yi Zhang https://orcid.org/0000-0001-8325-5954

Yue-Hong Cheng https://orcid.org/0000-0001-6263-0989

Min Liao https://orcid.org/0000-0001-6777-8579

Gui-Ying Liu https://orcid.org/0000-0003-4905-2429

Pan-Yan Yang https://orcid.org/0009-0004-0722-8953

Bo Xu https://orcid.org/0000-0003-3507-9321

Hai He https://orcid.org/0000-0001-5362-9177

Data availability

All of the data that support the findings of this study are available in the main text or Appendix 1.

References

  • Beentje H (2012) The Kew Plant Glossary, an illustrated dictionary of plant terms. Kew Publishing, London, 164 pp.
  • Chase MW, Cameron KM, Freudenstein JV, Pridgeon AM, Salazar G, Berg CVD, Schuiteman A (2015) An updated classification of Orchidaceae. Botanical Journal of the Linnean Society 177(2): 151–174. https://doi.org/10.1111/boj.12234
  • Chen SC, Tsi ZH, Wood JJ (2009) Thrixspermum Lour. In: Wu ZY, Raven PH, Hong DY (Eds) Flora of China, vol. 19 (Orchidaceae). Missouri Botanical Garden Press, St. Louis and Science Press, Beijing, 336–342.
  • Govaerts R, Campacci MA, Baptista DH, Baptista PJ, George A, Kreutz K, Wood JJ (2016) World Checklist of Orchidaceae. The Board of Trustees of the Royal Botanic Gardens, Kew. http://apps.kew.org/wcsp/
  • Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate Maximum-Likelihood phylogenies: Assessing the performance of PhyML 3.0. Systematic Biology 59(3): 307–321. https://doi.org/10.1093/sysbio/syq010
  • Hayata B (1916) Icones Plantarum Formosarum nec non et contributiones ad floram Formosanam, vol. 6. Governmnet of Formosa, Taihoku, 168 pp.
  • Holttum RE (1960) The genera Sarcochilus R. Br. and Pteroceras Hassk. (Orchidaceae) with notes on other genera which have been included in Sarcochilus. Kew Bulletin 14(2): 263–276. https://doi.org/10.2307/4114807
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010
  • King G, Pantling R (1898) Orchids of the Sikkim-Himalaya. Annals of the Royal Botanic Garden, Calcutta 8: 207.
  • Li MH, Zhang GQ, Liu ZJ, Lan SR (2014) Revision of Hygrochilus (Orchidaceae: Epidendroideae: Aeridinae) and a molecular phylogenetic analysis. Phytotaxa 159(4): 256–268. https://doi.org/10.11646/phytotaxa.159.4.2
  • Loureiro J (1790) Flora Cochinchinensis vols. 1–2. Typis et Expensis Academicis, Lisbon, 744 pp.
  • Minh BQ, Nguyen MAT, von-Haeseler A (2013) Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution 30(5): 1188–1195. https://doi.org/10.1093/molbev/mst024
  • Miquel FAW (1866) Prolusio florae laponicae. Annales Musei Botanici Lugduno-Batavi 2: 69–212, 257–300.
  • Nguyen LT, Schmidt HA, Von-Haeseler A, Minh BQ (2014) IQ-TREE: A fast and effective stochastic algorithm for estimating Maximum-Likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Reichenbach HG (1878) Ad Orchidographiam Japonicam Symbolae. Botanische Zeitung (Berlin) 36: 74–76.
  • Sang T, Crawford D, Stuessy T (1997) Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84(8): 1120–1136. https://doi.org/10.2307/2446155
  • Schlechter FRR (1919) Orchideologiae Sino-Japonicae prodromus. Eine kritische Besprechtung der Orchideen Ost-Asien. Repertorium Specierum Novarum Regni Vegetabilis. Beihefte 4: 1–319.
  • Song XQ, Meng QW, Wing YT, Luo YB (2009) Thrixspermum odoratum (Orchidaceae), a new species from Hainan Island, China. Annales Botanici Fennici 46(6): 595–598. https://doi.org/10.5735/085.046.0617
  • Sun Y, Skinner D, Liang G, Hulbert S (1994) Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics 89(1): 26–32. https://doi.org/10.1007/BF00226978
  • Swofford DL (2002) PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4.0 a169. Sinauer Associates, Sunderland.
  • Thiers B (2023) Index Herbariorum: a global directory of public herbaria and associated staff. New York Botanical Garden’s Virtual Herbarium. http://sweetgum.nybg.org/science/ih
  • Zhou ZH, Shi RH, Zhang Y, Xing XK, Jin XH (2021) Orchid conservation in China from 2000 to 2020: Achievements and perspectives. Plant Diversity 43(5): 343–349. https://doi.org/10.1016/j.pld.2021.06.003
  • Zou YJ, Chen ZJ, Kondo K, Funamoto T, Wen J, Zhou SL (2015) A molecular phylogeny of Aeridinae (Orchidaceae: Epidendroideae) inferred from multiple nuclear and chloroplast regions. Molecular Phylogenetics and Evolution 85: 247–254. https://doi.org/10.1016/j.ympev.2015.02.014

Appendix 1

Table A1.
Download as
CSV
XLSX

The GenBank accession numbers for DNA sequences used in this study.

Taxa Voucher nrITS psbA-trnH matK trnL-F
Abdominea minimiflora B200107222 AB217524 — — —
Cleisomeria pilosulum TBG140482 AB217542 — AB217718 —
Dimorphorchis lowii TBG118871 AB217548 — AB217724 —
Dimorphorchis rossii var. graciliscapa Botanical Garden Heidelberg 122351 EF670358 — EF655807 —
Microsaccus griffithii KFBG2673 KY966620 — — —
Phalaenopsis marriottiana Z. J. Liu 8743 KX579760 KX579764 KX579762 KX579766
Robiquetia bertholdii Chase 17866 — — FR832824 —
Robiquetia brevifolia WAMP_ORCH-13 MT505292 — — —
Robiquetia cerina Carlsward 210 (SEL) DQ091701 — — —
Robiquetia rosea WAMP_ORCH-14 MT505293 — — —
Robiquetia spathulata Z. J. Liu 6691 — KJ733523 KF421855 KJ733680
Robiquetia succisa Z. J. Liu 5248 KJ733444 KJ733524 KJ733601 KJ733681
Robiquetia virescens WAMP_ORCH-15 MT505294 — — —
Sarcochilus chrysanthus TBG145831 AB217582 — AB217757 —
Sarcochilus falcatus A. Perkins 14 AF321600 — — —
Sarcochilus fitzgeraldii Carlsward 231 (FLAS) DQ091728 — — —
Sarcochilus hartmannii TBG145793 AB217581 — AB217758 —
Sarcochilus hillii Perkins 15 AF321601 — — —
Thrixspermum amplexicaule Z. J. Liu 4971 KF545882 KF545871 KF545892 KF545904
Thrixspermum annamense Z. J. Liu 4972 KF545883 KF545872 KF545893 KF545905
Thrixspermum arachnites Heidelberg BG 104401 — — EF065572 —
Thrixspermum caudatum 1 KIP0690 KX679330 — — —
Thrixspermum caudatum 2 KIP0352 KX679331 — — —
Thrixspermum centipeda 1 KIP06 KX679341 — — —
Thrixspermum centipeda 2 KFBG3306AL KY966675 KJ733536 KJ733621 KJ733691
Thrixspermum elongatum Carlsward 170 (SEL) DQ091674 — — —
Thrixspermum formosanum 1 OT00257 — KJ733540 KJ733620 KJ733695
Thrixspermum formosanum 2 Yue-Hong Cheng 321 OR054228 OR062237 OR062232 OR062242
Thrixspermum japonicum 1 PDBK2015-1270 — KX871234 KX871234 KX871234
Thrixspermum japonicum 2 S. A. Choi 784 KT338782 KF262223 KF262105 —
Thrixspermum japonicum ZJY187 Jun-Yi Zhang & Yue-Hong Cheng ZJY187 OR054229 OR062238 OR062233 OR062243
Thrixspermum japonicum ZJY188 Jun-Yi Zhang & Yue-Hong Cheng ZJY188 OR054230 OR062239 OR062234 OR062244
Thrixspermum linusii KIP1150 KX679333 — — —
Thrixspermum merguense KIP1094 KX679334 — — —
Thrixspermum pugionifolium WAMP_ORCH-17 MT505296 — MT966905 —
Thrixspermum pygmaeum OT00263 KJ733457 KJ733537 KJ733613 KJ733692
Thrixspermum raciborskii AD7LN53 — MF348752 MF349945 —
Thrixspermum saruwatarii Z. J. Liu 3905 KJ733458 KJ733538 KJ733614 KJ733693
Thrixspermum sp. PPOP04 PPOP04 KX679342 — — —
Thrixspermum sp. HQ03 HQ03 KX679338 — — —
Thrixspermum sp. HQ04 HQ04 KX679339 — — —
Thrixspermum sp. KIP1127 KIP1127 KX679335 — — —
Thrixspermum sp. HQ02 HQ02 KX679337 — — —
Thrixspermum sp. HQ05 HQ05 KX679340 — — —
Thrixspermum sp. HQ01 HQ01 KX679336 — — —
Thrixspermum subulatum TBG113211 AB217592 — AB217768 —
Thrixspermum tortum KIP0185 KX679347 — — —
Thrixspermum triangulare HQ06 KX679348 — — —
Thrixspermum triangulare 980162 (L) EF670367 — — EF670412
Thrixspermum tsii Z. J. Liu 3264 KJ733459 KJ733539 KJ733615 KJ733694
Thrixspermum taeniophyllum ZJY144 Jun-Yi Zhang, Min Liao & Yue-Hong Cheng ZJY144 OP348891 OP373121 OP373116 OR184926
Thrixspermum taeniophyllum ZJY189 Jun-Yi Zhang, Min Liao & Yue-Hong Cheng ZJY189 OQ608783 OQ626556 OQ626557 OR184927
Thrixspermum taeniophyllum ZJY191 Jun-Yi Zhang, Min Liao & Yue-Hong Cheng ZJY191 OR054231 OR062240 OR062235 OR062245
Thrixspermum taeniophyllum ZJY192 Jun-Yi Zhang, Min Liao & Yue-Hong Cheng ZJY192 OR054232 OR062241 OR062236 OR062246
login to comment