Research Article |
|
Corresponding author: Bo Xu ( xubo@cib.ac.cn ) Corresponding author: Hai He ( hehaicq@gmail.com ) Academic editor: Murielle Simo-Droissart
© 2023 Jun-Yi Zhang, Yue-Hong Cheng, Min Liao, Gui-Ying Liu, Pan-Yan Yang, Bo Xu, Hai He.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Zhang J-Y, Cheng Y-H, Liao M, Liu G-Y, Yang P-Y, Xu B, He H (2023) Thrixspermum taeniophyllum (Orchidaceae, Epidendroideae), a new species from southwest China, based on molecular and morphological evidence. PhytoKeys 230: 145-156. https://doi.org/10.3897/phytokeys.230.104273
|
Thrixspermum taeniophyllum is described as a new orchid species from Wenchuan County, Sichuan Province of southwest China. It is morphologically similar to T. japonicum, but it differs from the latter in having branched stems, slightly fleshy strap-shaped leaves, longer inflorescences with 3–6 flowers and a capitate gynandrium with a lip-shaped mouth opening. Its species status is also supported by molecular phylogenetic analyses, based on nuclear ribosome internal transcribed spacer (nrITS) and three chloroplast DNA fragments (matK, psbA-trnH and trnL-F), which showed distinct systematic boundaries from the most morphologically similar T. japonicum and their morphological relatives T. saruwatarii and T. pygmaeum.
Epiphytic orchid, flora of Sichuan, phylogeny, systematic position, taxonomy
Thrixspermum Lour. (1790) is a genus of mostly medium-sized epiphytes and lithophytes in the family Orchidaceae Juss. and it is known to include ca. 160 species widely distributed from tropical and subtropical Asia to the islands of the western Pacific islands (
As part of a continuous inventory of orchids from Sichuan, China, we have conducted continuous field explorations in the Wenchuan section of the Giant Panda National Park. During a field trip in March 2022, we encountered an interesting epiphytic orchid in Wolong National Nature Reserve (Wenchuan County, Sichuan Province, China), that we had initially identified it as Thrixspermum japonicum, based on its pendulous inflorescence, golden-yellow flowers and orange-red striped lateral lobes of the labellum. However, upon a critical morphological observation and comparison with available specimens including the type materials of two of the three [we were unsuccessful to trace the type specimen(s) of T. pygmaeum (King & Pantl.)
Comparison of four species of Thrixspermum. Living plant of T. taeniophyllum (A), T. japonicum (B), T. saruwatarii (C) and T. pygmaeum (D); Detailed colour photos of T. japonicum (E: a habit b leaves c inflorescence d, e flower in front and back view f1 dorsal sepal f2–3 petals f4–5 sepals f6, h labellum g gynandrium and ovary i anther cap); Type specimens of T. taeniophyllum (F: holotype at CDBI), T. japonicum (G: holotype at L) and T. saruwatarii (H: holotype at TI); and a representative specimen of T. pygmaeum (I: TI). [Images A and E photographed by Min Liao; image B photographed by Yue-Hong Cheng; image C cited from website (https://kevinyu589.blogspot.com/) image D cited from website (https://www.gbif.org/species/2846707); the image of the type specimen of T. japonicum was obtained from JSTOR and those of T. saruwatarii and T. pygmaeum were cited from available from Plants of Taiwan (https://tai2.ntu.edu.tw/search/2)].
Morphological information (including the colour, size and shape of the roots, stems, leaves, flowers and floral parts, details see Table
Morphological comparison amongst Thrixspermum taeniophyllum, T. japonicum, T. saruwatarii and T. pygmaeum. Characters of the last three species are modified from the respective protologues (
| Character | T. taeniophyllum | T. japonicum | T. saruwatarii | T. pygmaeum |
|---|---|---|---|---|
| Stems | 4–8 cm long, often branched, internodes 5–8 mm | 3–13 cm long, unbranched, internodes 3–5 mm | shorter than 2 cm, unbranched, internodes ≤ 1 mm | shorter than 3 cm, unbranched, internodes ≤ 1 mm |
| Leaves | dichotomously alternate, slightly fleshy, strap-shaped, 5–7 × 0.5–1 cm | dichotomously alternate, thinly leathery, oblong, 2–4 × 0.5–0.7 cm | nearly basal, narrowly oblong or linear-oblanceolate, 4–8 × 0.5–2 cm | nearly basal, elliptic to linear-oblong, rarely falcate, 2–8 × 0.7–1.5 cm |
| Inflorescences | 6–12 cm long, with 3–6 flowers | 3–5 cm long, with 2–3 flowers | longer than 8 cm, with 1–4 flowers | 2–4 cm long, with 2–4 flowers |
| Floral bracts | broadly ovate-triangular, ca. 4 mm | broadly ovate-triangular, ca. 2.5 mm | ovate-triangular, 2–3 mm | ovate, 2–3 mm |
| Dorsal sepal | elliptic, 5–7 × 3.5–4.5 mm | oblong, 5–7 × 2.5–3 mm | oblong, 7–8 × 3–5 mm | elliptic, 6–8 × 4–5 mm |
| Lateral sepals | elliptic, 5–7 × 3.5–4.5 mm | ovate-lanceolate, 5–7 × 2.5–3 mm | slightly oblique, 7–8 × 3–5 mm | obliquely ovate, 6–7 × 4–5 mm |
| Petals | narrowly elliptic, 4.5–6 × 2–3 mm | narrowly oblong, 5–6 × 1.5–2 mm | linear, falcate, 5–6 × ca. 2 mm | oblong-spatulate, 6–7 × 2–3 mm |
| Lateral lobes of labellum | erect, nearly oblong, ca. 2.5 mm | narrowly ovate-oblong, ca. 2.5 mm | erect, falcate, ca. 3 mm | erect, oblong, falcate, 6–7 mm |
| Mid-lobe of labellum | fleshy, very small, teeth triangular | fleshy, very small, semi-orbicular | fleshy, very small, triangular | fleshy, small, semi-orbicular |
| Lip disc | without a callus, slightly depressed, with red purple or golden yellow hairs | with a callus, slightly depressed, densely tomentose | with a callus, where a tuft of brownish-yellowish hairs arises | without a callus, slightly depressed, with a tuft of purple hairs |
| Gynandrium | Capitate, mouth opening lip-shaped | conical, mouth opening triangular | cylindrical, mouth opening semi-lunar | cylindrical, mouth opening semi-lunar |
The sequences of four individuals of this new species from two different areas (Wolong and Gengda towns) in Wenchuan County and two individuals of T. japonicum (vouchers Jun-Yi Zhang & Yue-Hong Cheng ZJY187 and Jun-Yi Zhang & Yue-Hong Cheng ZJY188, deposited at CDBI) were newly obtained in this study with the following protocols. Total DNA was extracted from silica-gel dried leaves via a Plant DNA Isolation Kit (Cat.No.DE-06111, Foregene, Chengdu, China). The sequences were amplified by means of the primers (Table
| DNA markers | Length (bp) | Variable sites (bp) | Primer sequence (5’to3’) | Origin |
|---|---|---|---|---|
| nrITS | 675 | 239 | ACGAATTCATGGTCCGGTGAAGTGTTCG |
|
| GAATTCCCCGGTTCGCTCGCCGTTAC |
|
|||
| psbA-trnH | 748 | 44 | GTTATGCATGAACGTAATGCTC |
|
| CGCGCATGGTGGATTCACAAATC |
|
|||
| matK | 881 | 122 | CGATCTATTCATTCAATATTTC |
|
| TCTAGCACACGAAAGTCGA |
|
|||
| trnL-F | 908 | 94 | AAAATCGTGAGGGTTCAAGTC |
|
| GATTTGAACTGGTGACACGAG |
|
A total of 54 accessions representing 44 taxa were incorporated in the phylogenetic analysis, including Phalaenopsis marriottiana (Rchb. f.) Kocyan & Schuiteman (2014) as outgroup. The ingroup includes 36 entities of Thrixspermum representing 26 species and 17 taxa belonging to six related genera in Aeridinae (Orchidaceae, Epidendroideae) following the two previous studies of
The aligned nrITS matrix of 48 accessions (40 taxa) was 675 nucleotides in length with 239 variable sites and plastid matrix of 30 accessions (23 taxa) was 2537 nucleotides in length with 260 variable sites, of which 881 bp for matK (29 accessions, 22 taxa, 122 variable sites), 748 bp for psbA-trnH (20 accessions, 13 taxa, 44 variable sites) and 908 bp for trnL-F (19 accessions, 13 taxa, 94 variable sites), respectively (Table
Maximum Likelihood tree of 36 entities of Thrixspermum reconstructed, based on combined nuclear and plastid dataset. Numbers before slash indicate Bayesian posterior probabilities and numbers after slash indicate ML bootstrap supports for major lineages. Asterisk (*) indicates that a node is not supported in the analysis. The four individuals of the inferred new species are highlighted in red.
China. Sichuan Province, Wenchuan County, Wolong Town, in coniferous and broadleaf mixed forest, on tree trunks, elev. ca. 1762 m, in flower, 30 March 2022, Jun-Yi Zhang, Min Liao & Yue-Hong Cheng ZJY144 (holotype CDBI!).
It is most similar to Thrixspermum japonicum in morphology, but it differs from the latter by its often-branched stems (vs. unbranched stems), slightly fleshy strap-shaped leaves 5–7 cm long (vs. thinly leathery oblong leaves 2–4 cm long), longer inflorescences with 3–6 flowers (vs. shorter inflorescences with 2–3 flowers) and its capitate gynandrium with a lip-shaped mouth opening (vs. conical gynandrium with a triangular mouth opening). It also resembles T. saruwatarii and T. pygmaeum and morphological comparison amongst the four species is visualised in Fig.
Epiphytic on tree trunks. Roots vermiform and slender. Stems ascending or pendulous especially when in flowering, 4–8 cm long, ca. 1.5 mm thick, often branched, internodes 5–8 mm apart. Leaves green, dichotomously alternate, slightly fleshy, strap-shaped, 5–7 × 0.5–1 cm, apex acute and bifid with two unequally mucronate tips. Inflorescence arising from basal stem laterally or opposite to leaves, usually pendulous, 6–12 cm long; rachis slightly flexuous and slightly thickened distally, 4–6 cm long, laxly 3–6 flowered; bracts spirally arranged, obliquely patent, ca. 3 mm long, broadly ovate-triangular, apex acute. Flowers initially white and later turning creamy yellow, blossoming almost simultaneously; dorsal and lateral sepals similar, elliptic, 5–7 × 3.5–4.5 mm, apex obtuse, with obscure 3 veins; petals narrowly elliptic, smaller than sepals, 4.5–6 × 2–3 mm, apex obtuse, with obscure 1 or 2 veins; labellum small, three-lobed, base shallowly saccate; lateral lobes erect, triangularly oblong, ca. 2.5 mm, apex rounded or ± notched, inner surface with many purplish-red stripes; mid-lobe fleshy, reddish-brown, very small, apex ended with triangular teeth; disc concave, inside base densely covered with red purple or golden yellow hairs; gynandrium capitate, with a lip-shaped mouth opening; ca. 2.5 mm high; column foot ca. 1.2 mm, with one joint at the junction with the labellum; pollinia 4 grouped into two nearly similar masses, ca. 0.8 × 0.7 mm, yellow, full and obovately spherical. Fruits unseen.
Thrixspermum taeniophyllum was found in Wenchuan County, Sichuan Province, southwest China. It is epiphytic on trees in coniferous and broadleaf mixed forest at an elevational range between 1260 and 1770 m.
Flowering in March and April.
The specific epithet taeniophyllum is a compound adjective referring to the shape of leaves of this new species. A Chinese name, dai ye bai dian lan (带叶白点兰), is also suggested, based on the its leaf feature.
China. Sichuan Province, Wenchuan County, Wolong Town, evergreen broad-leaved forest, on tree trunks, elev. ca. 1769 m, in flower, 1 May 2023, Jun-Yi Zhang & Yue-Hong Cheng ZJY189 (CDBI!); Sichuan Province, Wenchuan County, Gengda Town, evergreen broad-leaved forest, on tree trunks, elev. ca. 1508 m, in flower, 2 May 2023, Jun-Yi Zhang & Yue-Hong Cheng ZJY191 (CDBI!); Sichuan Province, Wenchuan County, Gengda Town, evergreen broad-leaved forest, on tree trunks, elev. ca. 1520 m, in flower, 2 May 2023, Jun-Yi Zhang & Yue-Hong Cheng ZJY192 (CDBI!).
Japan. P. F. V. Siebold, s.n. (holotype L; It is not clear whether duplicates exist); China. Sichuan, Emeishan, elev. ca. 990 m, 12 July 1980, K. Y. Lang, B. C. Gao et al. 044 (PE); Baoxing, elev. ca. 1800 m, 2 April 1983, D. Y. Peng 47469 (CDBI!); Beichuan, elev. ca. 1640 m, 1 August 1984, C. L. Tang et al. 284 (CDBI!). Chongqing: Nanchuan, elev. ca. 900 m, 2 November 1983, Z. Y. Liu 4669 (IMC); Nanchuan, elev. ca. 850 m, 30 May 1984, Z. Y. Liu 5219 (PE).
China. Taiwan, Alishan, 8 April 1916, B. Hayata, s.n. (holotype TI); Kaohsiung, 20 October 1934, S. Sasaki, s.n. (TAI). Yunnan, Gongshan, elev. ca. 1702 m, 20 May 2007, X. H. Jin 9001 (PE). Hunan, Ningyuan, elev. ca. 340 m, 8 May 2011, X. L. Yu 11050801 (CSFI). Guangdong, Dapu, elev. ca. 700 m, 9 June 1957, L. Deng 4953 (IBSC).
China. Taiwan, Taipingshan, 3 April 1940, Y. Kobayashi, s.n. (TI); Taitung, 22 March 1932, S. Sasaki, s.n. (TAI); Miaoli, 13 November 1972, C. C. Hsu 12600 (TAI); Ilan, 10 March 2013, C. C. Hsu, s.n. (TAI).
| 1a | Stems shorter than 3 cm, internodes ≤ 1 mm; leaves nearly basal | 2 |
| 2a | Inflorescences longer than 8 cm; lip disc with a callus, where a tuft of brownish-yellowish hairs arises | T. saruwatarii |
| 2b | Inflorescences 2–4 cm long; lip disc without a callus, slightly depressed, with a tuft of purple hairs | T. pygmaeum |
| 1b | Stems longer than 3 cm, internodes ≥ 3 mm; leaves distichous alternate | 3 |
| 3a | Stems branched; leaves strap-shaped, 5–7 × 0.5–1 cm; inflorescences 6–12 cm long with 3–6 flowers and a capitate gynandrium with a lip-shaped mouth opening | T. taeniophyllum |
| 3b | Stems unbranched; leaves oblong, 2–4 × 0.5–0.7 cm; inflorescences 3–5 cm long with 2–3 flowers and a conical gynandrium with a triangular mouth opening | T. japonicum |
The authors have declared that no competing interests exist.
No ethical statement was reported.
This study was supported by the Second Tibetan Plateau Scientific Expedition and Research (STEP) programme (Grant Nos. 2019QZKK0301 & 2019QZKK0502), the National Key Research and Development Programme of China (Grant No. 2020YFE0203200), 2022 Central Finance Forestry Grassland Ecological Protection and Restoration National Park Subsidy Project, 2022–2023 Subsidy Projects of Prohibited Developmental Areas from the Transfer Payment of the National Key Ecological Functional Areas and Wild Plants Sharing and Service Platform of Sichuan Province.
JYZ, YHC, ML, GYL, PYY, HH and BX discovered and identified the species. YHC, GYL, and PYY assisted in extensive field investigation and samples collection. JYZ and ML performed the experiments and analyzed the data. JYZ wrote the manuscript. ML, HH and BX revised the manuscript. All authors read and approved last manuscript.
Jun-Yi Zhang https://orcid.org/0000-0001-8325-5954
Yue-Hong Cheng https://orcid.org/0000-0001-6263-0989
Min Liao https://orcid.org/0000-0001-6777-8579
Gui-Ying Liu https://orcid.org/0000-0003-4905-2429
Pan-Yan Yang https://orcid.org/0009-0004-0722-8953
All of the data that support the findings of this study are available in the main text or Appendix
| Taxa | Voucher | nrITS | psbA-trnH | matK | trnL-F |
|---|---|---|---|---|---|
| Abdominea minimiflora | B200107222 | AB217524 | — | — | — |
| Cleisomeria pilosulum | TBG140482 | AB217542 | — | AB217718 | — |
| Dimorphorchis lowii | TBG118871 | AB217548 | — | AB217724 | — |
| Dimorphorchis rossii var. graciliscapa | Botanical Garden Heidelberg 122351 | EF670358 | — | EF655807 | — |
| Microsaccus griffithii | KFBG2673 | KY966620 | — | — | — |
| Phalaenopsis marriottiana | Z. J. Liu 8743 | KX579760 | KX579764 | KX579762 | KX579766 |
| Robiquetia bertholdii | Chase 17866 | — | — | FR832824 | — |
| Robiquetia brevifolia | WAMP_ORCH-13 | MT505292 | — | — | — |
| Robiquetia cerina | Carlsward 210 (SEL) | DQ091701 | — | — | — |
| Robiquetia rosea | WAMP_ORCH-14 | MT505293 | — | — | — |
| Robiquetia spathulata | Z. J. Liu 6691 | — | KJ733523 | KF421855 | KJ733680 |
| Robiquetia succisa | Z. J. Liu 5248 | KJ733444 | KJ733524 | KJ733601 | KJ733681 |
| Robiquetia virescens | WAMP_ORCH-15 | MT505294 | — | — | — |
| Sarcochilus chrysanthus | TBG145831 | AB217582 | — | AB217757 | — |
| Sarcochilus falcatus | A. Perkins 14 | AF321600 | — | — | — |
| Sarcochilus fitzgeraldii | Carlsward 231 (FLAS) | DQ091728 | — | — | — |
| Sarcochilus hartmannii | TBG145793 | AB217581 | — | AB217758 | — |
| Sarcochilus hillii | Perkins 15 | AF321601 | — | — | — |
| Thrixspermum amplexicaule | Z. J. Liu 4971 | KF545882 | KF545871 | KF545892 | KF545904 |
| Thrixspermum annamense | Z. J. Liu 4972 | KF545883 | KF545872 | KF545893 | KF545905 |
| Thrixspermum arachnites | Heidelberg BG 104401 | — | — | EF065572 | — |
| Thrixspermum caudatum 1 | KIP0690 | KX679330 | — | — | — |
| Thrixspermum caudatum 2 | KIP0352 | KX679331 | — | — | — |
| Thrixspermum centipeda 1 | KIP06 | KX679341 | — | — | — |
| Thrixspermum centipeda 2 | KFBG3306AL | KY966675 | KJ733536 | KJ733621 | KJ733691 |
| Thrixspermum elongatum | Carlsward 170 (SEL) | DQ091674 | — | — | — |
| Thrixspermum formosanum 1 | OT00257 | — | KJ733540 | KJ733620 | KJ733695 |
| Thrixspermum formosanum 2 | Yue-Hong Cheng 321 | OR054228 | OR062237 | OR062232 | OR062242 |
| Thrixspermum japonicum 1 | PDBK2015-1270 | — | KX871234 | KX871234 | KX871234 |
| Thrixspermum japonicum 2 | S. A. Choi 784 | KT338782 | KF262223 | KF262105 | — |
| Thrixspermum japonicum ZJY187 | Jun-Yi Zhang & Yue-Hong Cheng ZJY187 | OR054229 | OR062238 | OR062233 | OR062243 |
| Thrixspermum japonicum ZJY188 | Jun-Yi Zhang & Yue-Hong Cheng ZJY188 | OR054230 | OR062239 | OR062234 | OR062244 |
| Thrixspermum linusii | KIP1150 | KX679333 | — | — | — |
| Thrixspermum merguense | KIP1094 | KX679334 | — | — | — |
| Thrixspermum pugionifolium | WAMP_ORCH-17 | MT505296 | — | MT966905 | — |
| Thrixspermum pygmaeum | OT00263 | KJ733457 | KJ733537 | KJ733613 | KJ733692 |
| Thrixspermum raciborskii | AD7LN53 | — | MF348752 | MF349945 | — |
| Thrixspermum saruwatarii | Z. J. Liu 3905 | KJ733458 | KJ733538 | KJ733614 | KJ733693 |
| Thrixspermum sp. PPOP04 | PPOP04 | KX679342 | — | — | — |
| Thrixspermum sp. HQ03 | HQ03 | KX679338 | — | — | — |
| Thrixspermum sp. HQ04 | HQ04 | KX679339 | — | — | — |
| Thrixspermum sp. KIP1127 | KIP1127 | KX679335 | — | — | — |
| Thrixspermum sp. HQ02 | HQ02 | KX679337 | — | — | — |
| Thrixspermum sp. HQ05 | HQ05 | KX679340 | — | — | — |
| Thrixspermum sp. HQ01 | HQ01 | KX679336 | — | — | — |
| Thrixspermum subulatum | TBG113211 | AB217592 | — | AB217768 | — |
| Thrixspermum tortum | KIP0185 | KX679347 | — | — | — |
| Thrixspermum triangulare | HQ06 | KX679348 | — | — | — |
| Thrixspermum triangulare | 980162 (L) | EF670367 | — | — | EF670412 |
| Thrixspermum tsii | Z. J. Liu 3264 | KJ733459 | KJ733539 | KJ733615 | KJ733694 |
| Thrixspermum taeniophyllum ZJY144 | Jun-Yi Zhang, Min Liao & Yue-Hong Cheng ZJY144 | OP348891 | OP373121 | OP373116 | OR184926 |
| Thrixspermum taeniophyllum ZJY189 | Jun-Yi Zhang, Min Liao & Yue-Hong Cheng ZJY189 | OQ608783 | OQ626556 | OQ626557 | OR184927 |
| Thrixspermum taeniophyllum ZJY191 | Jun-Yi Zhang, Min Liao & Yue-Hong Cheng ZJY191 | OR054231 | OR062240 | OR062235 | OR062245 |
| Thrixspermum taeniophyllum ZJY192 | Jun-Yi Zhang, Min Liao & Yue-Hong Cheng ZJY192 | OR054232 | OR062241 | OR062236 | OR062246 |