Research Article
Print
Research Article
Morphology and molecular phylogeny of Pleurosigma pacificum sp. nov. (Pleurosigmataceae), a new tropical pelagic species from the Western Pacific Ocean
expand article infoFei-Chao Du‡§, Yu-Hang Li§, Kui-Dong Xu|§‡
‡ University of Chinese Academy of Sciences, Beijing, China
§ Institute of Oceanology, Chinese Academy of Sciences, Qingdao, China
| Pilot National Laboratory for Marine Science and Technology, Qingdao, China

Corresponding author: Kui-Dong Xu ( kxu@qdio.ac.cn )

Academic editor: Bing Liu
© 2023 Fei-Chao Du, Yu-Hang Li, Kui-Dong Xu.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Du F-C, Li Y-H, Xu K-D (2023) Morphology and molecular phylogeny of Pleurosigma pacificum sp. nov. (Pleurosigmataceae), a new tropical pelagic species from the Western Pacific Ocean. PhytoKeys 227: 99-108. https://doi.org/10.3897/phytokeys.227.103890
Open Access

Abstract

A new species of pelagic diatom, Pleurosigma pacificum sp. nov., is described from the tropical Western Pacific Ocean. It has the typical features of Pleurosigma, including a slightly sigmoid raphe, intersected transverse and oblique striae, and loculate areolae with external opening slits and internal poroids. Morphologically, P. pacificum belongs to a species group of Pleurosigma with lanceolate valves, including P. atlanticum Heiden & Kolbe, P. nubecula W. Smith, P. indicum Simonsen, and P. simonsenii Hasle. However, P. pacificum differs by its smaller lanceolate valve and smaller intersection angle as well as elliptical areolae without a silica bar. The SSU rDNA and rbcL sequence data place P. pacificum in a basal position relative to other species of Pleurosigma. Our molecular phylogenetic analyses did not support the monophyly of lanceolate and slightly sigmoid species. Thus, the sigmoidality of valve outline cannot be considered as a criterion to define the species group.

Key words

Marine diatoms, morphology, new species, phylogeny, Pleurosigma, Western Pacific Ocean

Introduction

Smith (1852) established the genus Pleurosigma W. Smith for some sigmoid naviculoid diatoms. Peragallo (1891) clarified the infrageneric delimitation by combining the orientation of the striae and their angle of the intersection. Species with transverse and oblique striae were separated from those with transverse and longitudinal striae as well as species with centrally interrupted striae. Subsequently, Cleve (1894) transferred all those species with transverse and longitudinal striae into the genus Gyrosigma and retained species with transverse and oblique striae in the genus Pleurosigma. Hendey (1964) gave a clearer delimitation of Pleurosigma and provided chloroplast characters. Round et al. (1990) and Reid (2012) used ultrastructural features for their description of Pleurosigma. Currently, Pleurosigma is characterized by having two or four ribbon-like plastids, (slightly) sigmoid valves, transverse and two obliquely intersecting striae and loculate areolae with external opeing slits and internal poroids (Round et al. 1990; Reid and Williams 2003; Sterrenburg et al. 2005; Reid 2012). To date, this genus contains more than 700 named taxa (Kociolek et al. 2021).

Pleurosigma is a group of diatoms that is widely disturbed in brackish to marine environments (Round et al. 1990; Sterrenburg et al. 2003). It is predominantly found as a large population on sediments (Reid 2012) with a sigmoid valve or raphe, but some Pleurosigma species have lanceolate or nearly straight valves and are commonly found in planktonic samples. Metabarcoding data have revealed that Pleurosigma species are highly diverse in pelagic ocean (Malviya et al. 2016). However, only five species are known to be pelagic, namely P. antarcticum Grunow, P. atlanticum Heiden & Kolbe, P. indicum Simonsen, P. simonsenii Hasle and P. directum Grunow (Cleve and Möller 1877–1882; Heiden 1928; Simonsen 1974; Sar et al. 2012).

In this paper, we describe a new species of Pleurosigma isolated from the tropical Western Pacific Ocean by using light microscopy (LM) and scanning electron microscopy (SEM). Its phylogenetic position is determined by DNA sequence.

Materials and methods

Sampling, cultivation and morphological observation

Phytoplankton samples were collected from upper 200 m water column by using a phytoplankton net (64 µm mesh), on the Western Pacific Ocean (7°0.26'N, 141°59.63'E). Single cells of diatoms were isolated using capillary pipettes and cultivated in F/2 medium. Cultures were maintained at 24–26 °C under a light intensity of 120–150 µmol photon/m2/s, with a light/dark cycle of 12:12 h. Five milliliters of vegetative cells were fixed with 2.5% glutaraldehyde and then cleaned with hydrogen peroxide (Trobajo and Mann 2019). For LM observation, cleaned samples were mounted on glass slides with Mountmedia (Wako Pure Chemical Industries, Ltd., Osaka, Japan). A Zeiss Imager Z2 microscope (Carl Zeiss Microimaging GmbH, Jena, Germany) with differential interference contrast (DIC) was used for LM observation. The measurement methods of the raphe angle and the intersection angle of the oblique striae followed Sterrenburg (1991). For SEM observations, specimens were placed on coverslips, air-dried and coated with osmium. A Hitachi S-4800 (Hitachi, Ltd., Tokyo, Japan) was used for SEM observation.

DNA extraction and sequencing

The DNA was extracted and sequenced according to the method described in Li et al. (2022). Algal cell pellets were obtained by centrifuged 10 mL diatom cultures at 5,000 g for 5 min. Total DNA was extracted by using the Plant Genomic DNA Kit (Tiangen Biotech Co., Beijing, China). The small-subunit ribosomal DNA (SSU rDNA), large-subunit ribosomal DNA (LSU rDNA), chloroplast-encoded genes rbcL and psbC were amplified by polymerase chain reaction (PCR). Forward and reverse strands were amplified using the follow primes (Table 1). The PCR cycles of the four markers follow Alverson et al. (2007). The PCR products were purified using TIANgel Midi Purification Kit (Tiangen Biotech Co., China) and sequenced by Tsingke Biotechnology Co.,Ltd. (Beijing, China).

Table 1.
Download as
CSV
XLSX

Primers used to amplify SSU rDNA, LSU rDNA, rbcL and psbC fragments for P. pacificum.

Name Marker Sequence (5′ to 3′) Reference
SSU1 SSU AACCTGGTTGATCCTGCCAGT (Medlin et al. 1988)
ITS1DR SSU CCTTGTTACGACTTCACCTTCC (Edgar and Theriot 2004)
D1R LSU ACCCGCTGAATTTAAGCATA (Scholin et al. 1994)
D3Ca LSU ACGAACGATTTGCACGTCAG (Lenaers et al. 1989)
rbcL 66+ rbcL TTAAGGAGAAATAAATGTCTCAATCTG (Alverson et al. 2007)
rbcL 1444- rbcL GCGAAATCAGCTGTATCTGTW G (Ruck and Theriot 2011)
psbC+ psbC CACGACCWGAATGCCACCAAT (Alverson et al. 2007)
psbC- psbC ACAGGMTTYGCTTGGTGGAGTGG (Alverson et al. 2007)

Molecular phylogenetic analyses

To examine the phylogenetic position of P. pacificum, a two-gene dataset (SSU rDNA–rbcL) including 30 recognized species and 12 unnamed strains, was used to construct the phylogenetic trees (Suppl. material 1). Due to the lack of LSU rDNA and psbC data of most Pleurosigma species in GenBank, the two genes were not used for the phylogenetic analysis. Since a previous molecular phylogenetic study indicates that Pleurosigmataceae is closely related to Haslea and Navicula (Li et al. 2017), we selected all the available sequence of Pleurosigmataceae and Haslea species in GenBank for analysis. For Navicula species, we selected sequences of species with voucher slides or reliable morphological data.

The SSU rDNA and rbcL sequences were aligned using MAFFT v.7.313 (Katoh and Standley 2013) with normal mode and Q-INS-I strategy which considered the secondary structure of RNA, respectively. The trimAl was used to trim the alignment with parameter automated1 (Capella-Gutiérrez et al. 2009). The final concatenated alignment included 2,224 positions, of which 1,535 columns were SSU rDNA and 689 were rbcL. PartitionFinder 2 was used to select best-fit models for ML and BI analysis (Lanfear et al. 2017), according to the Bayesian information criterion (BIC). The rbcL gene was partitioned by codon position. IQ-TREE v.1.6.8 (Nguyen et al. 2015), Mrbayes v.3.2.7 (Huelsenbeck and Ronquist 2001) and TNT v.1.6 (Goloboff and Morales 2023) were used to perform maximum likelihood (ML), Bayesian inference (BI) and maximum parsimony (MP) analysis, respectively. The ML analysis with 1,000 bootstrap was executed with the default settings. The BI program was run for 107 generations with samples every 1,000 generations and the first 25% of trees were discarded as burn-in. Convergence was judged based on the average standard deviation of split frequencies (all less than 0.01) and the ESS values (more than 3,000) were analyzed in the R package RWTY (Warren et al. 2017). The consensus topology and posterior probabilities of all branches were derived from the remaining trees using a majority-rule consensus approach. In the MP analysis, we used a traditional search with TBR branch swapping on 1,000 replicates and holding 10 trees per replication. The resulting 31 most parsimonious trees (MPTs) were used to calculate a strict consensus tree; Standard bootstrap and Jacknife (with 35 removal probability) analyses were performed using a traditional search and 1,000 replicates, with outputs saved as frequency differences. FigTree v.1.4.4 and Adobe Illustrator were used to view and edit trees.

Results

Pleurosigma pacificum sp. nov.

Fig. 1, Table 2

Description

Valves lanceolate, gradually tapering towards the subacute ends, 45.0–51.5 µm long and 13.0–15.6 µm wide (Fig. 1A–D). Raphe filiform, straight, slightly curved near poles (Fig. 1A–D). Raphe angle +2° to +4°. Valve center roundish (Fig. 1E, arrowhead). Terminal area funnel-shaped (Fig. 1F). Transverse striae straight, parallel throughout, 21–22 in 10 µm, oblique striae 21–23 in 10 µm, intersecting at an angle between 32° to 35°.

Figure 1. 

A–F LM photographs of P. pacificum A–D cleaned frustules showing parallel transverse striae under LM E valve center showing a roundish central area (arrowhead) F funnel-shaped terminal area in apical position G–L SEM photographs of P. pacificum G internal view of the whole valve H internal valve central area showing straight, slight expanded raphe fissures (arrowhead) and nodule bordered by two arched bars I internal raphe fissures terminate in helictoglossae at the apices (arrowhead) J external view of the whole valve showing the terminal fissures curving into opposite directions K external central area of valve showing straight, simple raphe fissures (arrowhead) L terminal fissures (arrowhead). Scale bars: 10 μm (A–F); 5 μm (G, J); 1 μm (H, I, K, L).

In SEM, internally, raphe fissures terminate in helictoglossae at apices, orientated in opposite direction to one another (Fig. 1G, I, arrowhead). Internal central fissures straight, slightly expanded (Fig. 1H, arrowhead). Central nodule is raised and flanked by two central bars (Fig. 1H). External central raphe fissures straight, simple (Fig. 1K, arrowhead). Terminal fissures bent to opposite side of valve, not extending onto valve mantle (Fig. 1L, arrowhead). Areolae loculate with external opening slits and internal poroids (Fig. 1G, J).

Holotype

MBMCAS286904, an example is illustrated in Fig. 1A, E, F. This slide was deposited in the Marine Biological Museum, Chinese Academy of Sciences, Qingdao, China.

Isotype

MBMCAS286905, an example is illustrated in Fig. 1C. This slide was deposited in the Marine Biological Museum, Chinese Academy of Sciences, Qingdao, China.

Type locality

7°0.26'N, 141°59.63'E, the upper 200 m water column in the tropical Western Pacific Ocean.

Etymology

Named after the Pacific Ocean where the species was discovered.

Distribution and ecology

Pleurosigma pacificum is a planktonic species known only from the type locality. The water temperature was 28.5 °C and salinity about 33.4 during sampling.

Gene sequences

These sequences were deposited in the GenBank (SSU rDNA OQ437519, LSU rDNA OQ549922, rbcL OQ473490 and psbC OQ437519).

PhycoBank registration

http://phycobank.org/103761.

Molecular phylogenetic analyses

The BLASTn search showed that the SSU rDNA sequence of P. pacificum shares 97.65% identity with an uncultured marine eukaryote (KC771201). The rbcL gene sequence of P. pacificum shares 92.54% identity with P. intermedium (NC_066077). The ML, BI and MP phylogenetic tree based on the concatenated SSU rDNA and rbcL gene showed that P. pacificum belongs to the clade of the genus Pleurosigma with high support (IQ-TREE ultrafast bootstrap value = 99, Mrbayes posterior probability = 1.00, MP standard boostrap value = 77 and MP jacknife value = 85). The P. pacificum is basal to all other species of Pleurosigma, and branched earlier than the two slightly sigmoid species, P. planctonicum and P. intermedium (Fig. 2, Suppl. material 2).

Figure 2. 

Maximum likelihood (ML) and Bayesian inference (BI) phylogenetic trees based on the concatenated SSU rDNA and rbcL sequences. The values on each node indicate ML bootstrap and Bayesian posterior probabilities (%), respectively. Only bootstrap values over 50% are shown on the tree. Black dot indicate ML/BI = 100/1.00. The asterisk indicates the topological incongruence between ML and BI trees.

Discussion

The valves of Pleurosigma pacificum sp. nov. possess intersected transverse and oblique striae, opposite curved raphe distal endings, two internal central bars, and loculate areolae with an internal poroids and an external slit opening. These are considered to be the main characters of the genus Pleurosigma (Hendey 1964; Reid 2002; Sterrenburg et al. 2005). Molecular data place P. pacificum in a basal position relative to other species of Pleurosigma.

The morphological data place P. pacificum in a group of species, which includes P. nubecula W. Smith, P. indicum Simonsen, P. simonsenii Hasle, and P. atlanticum Heiden & Kolbe, with lanceolate valves and a straight raphe (Table 2). Among them, P. pacificum can be easily distinguished from P. simonsenii by its much smaller valves (45.0–51.5 µm vs. 300–600 µm long). P. pacificum differs from P. indicum as its internal poroids of areolae are not bisected by a central bar (Fig. 1G in this study vs. figs 41 and 42 in Sar et al. 2012), and from P. atlanticum and P. nubecula by the smaller stria angle (32–35° in P. pacificum, 60° in P. atlanticum and 60–61° in P. nubecula).

Table 2.
Download as
CSV
XLSX

Comparison of morphological features of Pleurosigma pacificum sp. nov. with similar species.

Characteristics P. pacificum sp. nov. P. simonsenii # P. indicum P. atlanticum P. nubecula
Length (µm) 45.0–51.5 300–600 70–90 69–76 82–85
Width (µm) 13.0–15.6 40–75 8–11 13.0–16.5 16
Raphe angle 2–3° ND 2.5–2.6° 1.2° 1.2–1.9°
Transverse striae in 10 µm 21–22 28–30 23–28 20 25–26
Oblique striae in 10 µm 21–23 30 20–24 20 23–25
Stria angle 32–35° 60° 44–48° 60° 60–61°
Valve outline lanceolate Lanceolate, slightly sigmoid Lanceolate, slightly sigmoid Lanceolate Narrowly lanceolate
Raphe Straight, slightly deflected near the apices Straight, sigmoid before the ends Straight, eccentric towards the ends Straight, slightly deflected at poles Very slightly deflected
Apices Subacute very acute Subacute Blunt rounded obtuse Subacute
Internal view areolae elliptical without bars ND elliptical, bisected by a narrow silica bar ND elliptical, bisected by a narrow silica bar
Sources This study (n = 20) Simonsen (1974) Simonsen (1974); Sar et al. (2012) Heiden and Kolbe (1928) Sar et al. (2012)

ND = not documented. #Identified as P. planctonicum in original description.

The definition of the genus Pleurosigma has undergone constant debate and modifications (Cleve 1894; Hendey 1964; Round et al. 1990; Reid 2012). Pleurosigma is characterized by its (slightly) sigmoid valve and raphe, two or four ribbon-like chloroplasts, areolae opening to outside by elongate slits and inside by a poroid, areolae arranged in decussate rows, and central internal raphe ending in a central nodule. Reid (2012) indiates that the equal thickening of the raphe sternum on both sides of raphe is a synapomorphic feature of Pleurosigma and further revised the generic definition based on morphological phylogenetic analyses. Although Reid (2012) did not include any slightly sigmoid Pleurosgima species, recent studies and the present work showed that all these lanceolate and slightly sigmoid Pleurosigma species share this synapomorphic feature as well as the other features mentioned above (Sar et al. 2012; Sterrenburg et al. 2015). However, our molecular phylogenetic analyses did not support the monophyly of these lanceolate and slightly sigmoid species (Fig. 2, Suppl. material 2). Therefore, the sigmoidality of valve outline cannot be considered as a criterion to define the species group.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (Grant numbers 42276099 and 31800171). This work was also supported by Oceanographic Data Center, Institute of Oceanology, Chinese Academy of Sciences. We are very grateful to two reviewers and the editors for their careful revisions and constructive comments. We are also grateful to staff of the Research Vessel KEXUE for sample collection.

Additional information

Conflict of interest

No conflict of interest was declared.

Ethical statement

No ethical statement was reported.

Funding

No funding was reported.

Author contributions

Conceptualization: KDX. Funding acquisition: YHL. Investigation: FCD. Methodology: YHL. Supervision: KDX. Writing - original draft: FCD. Writing - review and editing: YHL, KDX.

Author ORCIDs

Fei-Chao Du https://orcid.org/0009-0005-0674-5761

Yu-Hang Li https://orcid.org/0000-0002-5546-1774

Kui-Dong Xu https://orcid.org/0000-0002-5186-519X

Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

References

  • Alverson AJ, Jansen RK, Theriot EC (2007) Bridging the Rubicon: Phylogenetic analysis reveals repeated colonizations of marine and fresh waters by thalassiosiroid diatoms. Molecular Phylogenetics and Evolution 45(1): 193–210. https://doi.org/10.1016/j.ympev.2007.03.024
  • Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T (2009) trimAl: A tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 25(15): 1972–1973. https://doi.org/10.1093/bioinformatics/btp348
  • Cleve PT (1894) Synopsis of the naviculoid diatoms. Kongliga Svenska Vetenskaps Akademiens Handlingar 26(2): 1–194.
  • Cleve PT, Möller JD (1877–1882) Diatoms (Exsiccata) edited by Cleve PT and Möller JD. Esaias Edquists Boktryckeri, Upsala, 1–38.
  • Goloboff PA, Morales ME (2023) TNT version 1.6, with a graphical interface for MacOS and Linux, including new routines in parallel. Cladistics 39(2): 144–153. https://doi.org/10.1111/cla.12524
  • Heiden H (1928) Die marinen diatomeen der Deutschen Sudpolar expedition 1901–3. Deutsche Sudpolar-Expedition 8: 447–715.
  • Hendey NI (1964) An introductory account of the smaller algae of British coastal waters. Part 5 (Eds) Bacillariophyceae (Diatoms). Her Majesty Stationery Office, London, 1–317.
  • Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. https://doi.org/10.1093/molbev/mst010
  • Kociolek JP, Blanco S, Coste M, Ector L, Liu Y, Karthick B, Kulikovskiy M, Lundholm N, Ludwig T, Potapova M, Rimet F, Sabbe K, Sala S, Sar E, Taylor J, Van de Vijver B, Wetzel CE, Williams DM, Witkowski A, Witkowski J (2021) DiatomBase. Pleurosigma W. Smith, 1852. http://diatombase.org/aphia.php?p=taxdetails&id=149181 [Accessed on 15.12.2022]
  • Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2017) PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34(3): 772–773. https://doi.org/10.1093/molbev/msw260
  • Lenaers G, Maroteaux L, Michot B, Herzog M (1989) Dinoflagellates in evolution. A molecular phylogenetic analysis of large subunit ribosomal RNA. Journal of Molecular Evolution 29(1): 40–51. https://doi.org/10.1007/BF02106180
  • Li Y, Chen X, Sun Z, Xu K (2017) Taxonomy and molecular phylogeny of three marine benthic species of Haslea (Bacillariophyceae), with transfer of two species to Navicula. Diatom Research 32(4): 451–463. https://doi.org/10.1080/0269249X.2017.1401008
  • Li Y, Nagumo T, Xu K (2022) Morphology and molecular phylogeny of Amphora baotuensis sp. nov., a new freshwater benthic diatom from a karst spring in China. Diatom Research 37(2): 145–153. https://doi.org/10.1080/0269249X.2022.2063390
  • Malviya S, Scalco E, Audic S, Vincent F, Veluchamy A, Poulain J, Wincker P, Iudicone D, De Vargas C, Bittner L, Zingone A, Bowler C (2016) Insights into global diatom distribution and diversity in the world’s ocean. Proceedings of the National Academy of Sciences of the United States of America 113(11): E1516–E1525. https://doi.org/10.1073/pnas.1509523113
  • Nguyen L-T, Schmidt HA, Von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Peragallo H (1891) Monographie du genre Pleurosigma et des genres alliés. Le Diatomiste 1(4): 1–35.
  • Reid G (2012) A revision of the family Pleurosigmataceae (Bacillariophyta). A. R. G. Gantner, Ruggell, Liechtenstein, 1–115.
  • Round FE, Crawford RM, Mann DG (1990) The diatoms: biology and morphology of the genera. Cambridge university press, Cambridge, 1–774.
  • Sar EA, Hinz F, Sterrenburg FA, Lavigne AS, Lofeudo S, Sunesen I (2012) Species of Pleurosigma (Pleurosigmataceae) with lanceolate or slightly sigmoid valve outlines: Analysis of type material. Diatom Research 27(4): 237–253. https://doi.org/10.1080/0269249X.2012.720611
  • Scholin C, Villac M, Buck K, Krupp J, Powers D, Fryxell G, Chavez F (1994) Ribosomal DMA sequences discriminate among toxic and non‐toxic Pseudonitzschia species. Natural Toxins 2(4): 152–165. https://doi.org/10.1002/nt.2620020403
  • Simonsen R (1974) The diatom plankton of the Indian Ocean Expedition of R/V” Meteor” 1964–1965. Meteor Forschungsergebnisse: Reihe D. Biologie 19: 1–107.
  • Smith W (1852) Notes on the Diatomaceae with descriptions of the British species included in the genus Pleurosigma. Annals & Magazine of Natural History 29: 1–12.
  • Sterrenburg FA, Meave Del Castillo ME, Tiffany MA (2003) Studies on the Genera Gyrosigma and Pleurosigma (Bacillariophyceae): Pleurosigma species in the plankton from the Pacific coast of Mexico, with the description of P. gracilitatis sp. nov. Cryptogamie. Algologie 24(4): 291–306.
  • Sterrenburg F, Tiffany MA, Del Castillo MEM (2005) Valve morphogenesis in the diatom genus Pleurosigma W. Smith (Bacillariophyceae): Nature’s alternative sandwich. Journal of Nanoscience and Nanotechnology 5(1): 140–145. https://doi.org/10.1166/jnn.2005.012
  • Warren DL, Geneva AJ, Lanfear R (2017) RWTY (R We There Yet): An R package for examining convergence of Bayesian phylogenetic analyses. Molecular Biology and Evolution 34(4): 1016–1020. https://doi.org/10.1093/molbev/msw279

Supplementary materials

Supplementary material 1 

GenBank accession of SSU rDNA and rbcL gene sequences

Fei-Chao Du, Yu-Hang Li, Kui-Dong Xu

Data type: tables (pdf file)

Explanation note: GenBank accession of SSU rDNA and rbcL gene sequences derived from the species used in the phylogenetic analysis.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (274.83 kb)
Supplementary material 2 

Maximum parsimony (MP) phylogenetic trees based on the concatenated SSU rDNA and rbcL gene sequences

Fei-Chao Du, Yu-Hang Li, Kui-Dong Xu

Data type: figure (pdf file)

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (999.60 kb)
login to comment