Corresponding author: Qiang Zhou (
Academic editor: Alexander Sennikov
A new species
Peng J-Y, Zhang D-G, Deng T, Huang X-H, Chen J-T, Meng Y, Wang Y, Zhou Q (2022)
Libo County (Guizhou Province, China) belongs to the slope zone of transition from Guizhou Plateau to Guangxi Hilly Basin with typical karst topography and complex and diverse ecological environment (
Morphological examination and comparison of the new species with
To test the phylogenetic affiliation of
Primers used in this study.
Region | Name | Primer sequence (5´–3´) |
---|---|---|
|
ITS1 | AGAAGTCGTAACAAGGTTTCCGTAGG |
ITS4 | TCCTCCGCTTATTGATATGC | |
|
ndhCretF | AAGTTTCTCCGGTCCTTTGC |
trnVretR | TCTACGGTTCGAGTCCGTATAG |
Phylogenetic trees were constructed using Bayesian Inference (
Morphological observation (Fig.
Comparison of morphological characteristics among
|
|
|
|
---|---|---|---|
Height (cm) | 15–25 | 10–30 | 10–65 |
Leaf shape | Suborbicular or reniform, margin irregularly deltoid or rounded dentate, shallowly undulate or nearly entire | Suborbicular or reniform, margin coarsely repand or dentate with ovate-deltoid teeth | Orbicular or suborbicular, margin repand or lobed, with rounded or broadly deltoid mucronulate or obscurely mucronulate shallow teeth or lobes |
Leaf size (cm) | 2.5–4.5 × 2.5–6.5 | 2–6 × 2.5–7 | 1.5–6 × 2–6 |
Adaxial surface of leaf lamina | Green, densely or sparsely pubescent | Green or dark green, sparsely todensely villous or glabrous | Lustrous, green or deep green, densely or sparsely villous or glabrous |
Abaxial surface of leaf lamina | Pale green or purplish red, sparsely arachnoid or nearly glabrous | Deep purplish red, densely white tomentose, sparsely villous or glabrescent | Pale green or slightly purple with sparsely arachnoid, veins villous or pubescent |
Cauline leaves | 1–2, bract-like | 1–5, similar to radical ones | 1–2, bract-like |
Petiole base of cauline leaves | Expanded, not auriculate | Slightly expanded, not auriculate | Expanded, not auriculate |
Number of capitula | Usually1, sometimes 2 or 3 | 2–7 or more, rarely 1 | 1–7 (–10) or more |
Involucre | Calyculate | Calyculate | Not calyculate |
Phyllaries | 13 | 13 | 13 |
Chromosome number 2 |
48 | 48 | 48 |
Achene surface | Smooth, glabrous | Papillate, pubescent | Smooth, glabrous |
Pappus | Absent | Present | Present |
Geographical distribution | Guizhou | Guangxi, southwestern Hunan | Hunan, Sichuan, Chongqing, Guizhou, Yunnan |
The combined matrix of ITS and
Bayesian phylogenetic tree based on the combined data of ITS and
Several lines of evidence demonstrated that
China. Guizhou: Libo County, Lihua Town,
Scapigerous herbs. Rhizomes short and stout with many fibrous roots. Stems slender, scapiform, erect or declining, solitary or several, 13–22 cm long, basally reddish-brown and sparsely white villous, almost smooth in upper part. Radical leaves several; petiole ca. 3–6.5 cm long, densely villous or glabrescent, basally expanded, not auriculate; lamina suborbicular or reniform, ca. 2.5–4.5 × 2.5–6.5 cm, base cordate, margin irregularly triangular dentate, shallowly undulate or entire, apex slightly acute; adaxially green, densely or sparsely pubescent, abaxially pale green or purplish red, sparsely arachnoid or nearly glabrous. Upper leaves 1 or 2, bract-like, shortly petiolate, lanceolate. Capitula usually 1–3, peduncles slender, ca. 2–3.5 cm long, with a basal linear bracteole, or with 1–2 small linear bracteoles in the upper part. Involucres campanulate, calyculate with 2–3 bracteoles or more; phyllaries ca. 13, lanceolate, ca. 6 mm long, with ciliate margin, apically acute or obtuse and sometimes purplish. Ray florets ca. 13, corolla tube 3 mm long, glabrous; ray yellow, oblong, ca. 12 mm long, 4-veined, apically 3-denticulate. Disc florets numerous; corolla yellow, 4 mm, with ca. 1.5 mm glabrous tube and 0.85 mm limb. Anthers oblong, 5, ca. 1.2 mm long, basally obtuse. Style branches ca. 0.5 mm long, puberulent. Achenes ca. 1 mm long, smooth and glabrous. Pappus absent.
Holotype sheet of
Flowering from March to May, fruiting from April to June.
The species was named after Professor Qin-er Yang, an expert in the field of
Distribution of
1 | Pappus absent |
|
– | Pappus present. |
|
2 | Leaf lamina peltate |
|
– | Leaf lamina not peltate |
|
3 | Involucres calyculate |
|
– | Involucres ecalyculate. |
|
4 | Cauline leaf absent or 1 and bract-like; base of petiole of cauline leaf slightly auriculate; capitula solitary, rarely 2 or 3 |
|
– | Cauline leaves 1–5, similar to radical ones; base of petiole of cauline leaves never auriculate; capitula 1–5 or more |
|
5 | Ovaries and achenes glabrous |
|
– | Ovaries and achenes pubescent. |
|
6 | Leaf lamina broadly flabellate or suborbicular, dentate or palmately lobed to 1/2, lobes apically 2 or 3-denticulate, both surfaces glabrous |
|
– | Leaf lamina reniform or suborbicular, regularly 5–7-palmatilobed, lobes ovate-triangular, both surfaces glabrous or sometimes white tomentose abaxially and later glabrescent |
|
– | Leaf lamina ovate, broadly ovate, rarely ovate-orbicular, inconspicuously undulate-dentate, adaxial surface villous, sometimes sparsely arachnoid, and abaxial surface villous and densely white arachnoid |
|
7 | Stem erect or flexuous; cauline leaves 1–3; leaf lamina adaxially villous with spreading hairs; leaf auricles 4–10 mm in diameter |
|
– | Stem erect; cauline leaves 3–7; leaf lamina adaxially pubescent with appressed hairs or sparsely or densely white tomentose; leaf auricles 7–30 mm in diameter |
|
We thank Chu-miao Xie and Xin-yuan Kuai for preparing the line drawing and illustration. We are very grateful to Wen-guang Sun (Yunnan Normal University) for his help in the experimental part of the manuscript. This work was supported by the Ecological Adaptability of Four Narrow Endemic
GenBank accessions of species used in this study.
Species | GenBank accession number of ITS / |
---|---|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|