Corresponding author: Yue-Hong Yan (
Academic editor: Blanca León
Although taxonomists target the remote wild regions to discover new species, taxa lacking a comprehensive and modern systematic treatment may be the new hotspot for biodiversity discovery. The development of molecular systematics integrated with microscopic observation techniques has greatly improved the ability of taxonomists to identify species correctly.
Wei Z-Y, Xia Z-Q, Zhang X-C, Cao J-G, Yan Y-H (2021) Finding missing diversity from synonyms of
The question “How many species are there on earth?” is one of the top 125 questions in science, and exploring it is considered equivalent to imagining the number of stars in the sky (
Accurate specimen identification through sequencing of the type specimens or samples from type locality is the key to solving questions regarding taxonomic synonyms. In addition, a clear understanding of the taxonomic status and barcoding database of the species suspected of being independent is required.
In this study, we analyzed morphological characteristics and geographic distribution along with the molecular phylogeny to confirm the identity of
For morphology, the
The total genomic DNA was extracted from silica-dried leaves by using a plant total genomic DNA kit (Tiangen, Beijing, China), according to the manufacturer’s instructions. The primers used for amplification and sequencing were shown in Table
List of PCR amplification and sequencing primers used in the study.
Regions | Primer name | Primer sequence (5’-3’) | Reference |
---|---|---|---|
|
AF | ATGTCACCACAAACGGAGACTAAAGC |
|
ESRBCL1361R | TCAGGACTCCACTTACTAGCTTCACG |
|
|
|
ESATPF412F | GARCARGTTCGACAGCAAGT |
|
ESTRNR46F | GTATAGGTTCRARTCCTATTGGACG |
|
|
|
Vt matK1610F* | GCARTCAARCGTTTAATTRGTA |
|
Vt matK rRFQ | TTATTACTGAATTTGGRATCT |
|
|
|
Vt ndhF fAYS | GCTTATTCTACHATGTCTCAGYTRGGATATATGG |
|
Vt trnN 2210R | TCGTGARACGAAAATAGCAGTTTATGG |
|
|
|
F | ATTTGAACTGGTGACACGAG |
|
FernL 1Ir1 | GGYAATCCTGAGCCAAATC |
|
GenBank accession number of sequences newly generated in this study.
Species | Location | Voucher | GenBank accession number | ||||
---|---|---|---|---|---|---|---|
|
|
|
|
|
|||
|
Jiangxi, China | YYH15442-1 |
|
|
|
|
|
|
Jiangxi, China | YYH15442-2 |
|
|
|
|
|
|
Jiangxi, China | YYH15442-3 |
|
|
|
|
|
Information on species and GenBank accession numbers used in the study. Dash (-) indicates unavailable data.
Species | Location | Voucher | GenBank accession number | ||||
---|---|---|---|---|---|---|---|
|
|
|
|
|
|||
Luzon, Philippines | FWL974 | – | – |
|
|
|
|
Nantou, Taiwan, China | Chen1493 | – | – |
|
|
|
|
Yunnan, China | Kuo1418 | – | – |
|
|
|
|
Tamdao, Vietnam | Kuo1801 | – | – |
|
|
|
|
Sichuan, China | Kuo2225 |
|
|
|
|
|
|
Yunnan, China | Liu9457 |
|
|
|
|
|
|
Nantou, Taiwan | Chen1492 |
|
|
|
|
|
|
Hainan, China | Kuo1715 | – | – |
|
|
|
|
Yunnan, China | Kuo1142 | – | – |
|
|
|
|
Nantou, Taiwan, China | Chen1495 | – | – |
|
|
|
|
Taitung, Taiwan, China | Chen1502 |
|
|
|
|
|
The morphological and micromorphological characters of
Morphological comparisons between
|
|
|
Lamina width | 10–15 mm | 8–10 mm |
Lamina margin | Flat | Reflexed |
Adaxial costa | Slightly raised | Greatly raised |
Abaxial costa | Carinated | Sharp carinate |
Rhizome scale | Long, margin toothed | Short, lower margin subentire, upper part minutely denticulate |
Exospores | Scabrate | Psilate |
Sorus position | Between the frond costa and margin | Close to the lamina edge |
Morphological observations in
The two phylogenetic analyses (BI,
Genetic distance between eight individuals of five
|
|
|
|
|
|
|
|
2 | 0.073* | ||||||
3 | 0.120* | 0.001 | |||||
4 | 0.120* | 0 | 0 | ||||
5 | 0.120* | 0.001 | 0.001 | 0.001 | |||
6 | 0.120* | 0.001 | 0.001 | 0.001 | 0 | ||
7 | 0.120* | 0 | 0 | 0 | 0.001 | 0.001 | |
8 | 0.073* | 0 | 0 | 0.000 | 0.001 | 0.001 | 0 |
Note: 1 =
Majority consensus tree derived from Bayesian tree based on 5 cpDNA loci (
Geographic distribution of
Synonym is the first concern in the estimation of the total number of species in one taxon, and only after its resolution can one ask the next question regarding how many additional species there are in the taxon (
Various taxa, especially widely distributed ones, still require a comprehensive systematic treatment that also involves evaluating their nomenclature. Then, if cryptic taxa or misunderstood species have to be segregated, naming these taxa needs first to be evaluated against synonymy as potential sources of the needed name, otherwise a new name needs to be proposed. However, the number of taxonomists has significantly declined (
Trends in the number of new names, new combinations, and new taxa published over 50 years (1970–2020).
The reason for numerous synonyms existing only in books may be the lack of sufficient morphological judgments made in the past. In the present study, the phylogeny (Fig.
Here, we proposed a new combination
China. Hubei Province, Enshi Tujia and Miao Autonomous Prefecture, Hefeng District, elev. 1200 m, October 1958, Hong-Jun Li, 8394 (holotype, PE!; isotypes, IBSC!, NAS!).
We thank