Corresponding author: Hyoek Jae Choi (
Academic editor: L. Peruzzi
Jang JE, Park J-S, Jung J-Y, Kim D-K, Yang S, Choi HJ (2021) Notes on
With over 900 species (
The taxonomy of the section is complicated because of morphological diversity and hybridization involving polyploidy (
Here, we have combined morphological, cytological, and molecular characters to address the taxonomy of
This revision is based on the use of living and herbarium material, including photographs of type specimens, from the following herbaria: B, CBU, KB, KH, KWNU, LE, LINN, PE (abbreviations are according to
To analyze floral morphology known as a key character to distinguish
Root tips were pre-treated in distilled water on ice for 24 h in total darkness at 4 °C and then fixed in Carnoy’s fluid (3 parts absolute ethanol: 1 part glacial acetic acid, v/v) overnight at 4 °C. The root tips were macerated in 1M hydrochloric acid at 60 °C for 3–5 min. After washing 3–5 times to eliminate residual hydrochloric acid and staining with feulgen for 5 min, the material was squashed for observation in 2% aceto carmin. Observations and photographing of chromosome micrographs were made using an Olympus BX43 (Tokyo, Japan).
In this study, we investigated the application of concatenated cpDNA regions of
List of the markers used for the DNA barcoding and phylogenetic analysis.
Fragment | Marker | Sequence 5’ → 3’ | Reference |
---|---|---|---|
|
|
ATGCCYGAAAGTTGGATAGG |
|
TabE | GGTTCAAGTCCCTCTATCCC |
|
|
|
|
CGCGCATGGTGGATTCACAATCC |
|
|
GTTATGCATGAACGTAATGCTC |
|
|
|
|
CTCCGTARCCAGTCATCCATA |
|
CCCTTTTAACTCAGTGGTAG | |||
|
|
ATAGGTACTGTARCYGGTATT |
|
|
AACARTTYGARAAGGTTCAATT |
Total genomic DNA was extracted from silica gel-dried leaf materials using the DNeasy Plant Mini Kit (Qiagen, Seoul, South Korea). We conducted PCR with a ProFlex 96-Well PCR System (Applied Biosystems, Foster City, CA, USA). Each reaction mixture contained AccuPower PCR PreMix (Bioneer, Daejeon, South Korea), ca. 10 ng (1μL) of genomic DNA, and 100 pM of primers in a total volume of 20 µL. Conditions included an initial denaturation at 94 °C for 5 min, followed by 30 amplification cycles comprising 94 °C for 1 min, 54 °C for 1 min, and 72 °C for 1 min, with a final extension at 72 °C for 7 min. After the PCR products were visualized on 2% agarose gels, they were treated with a MG PCR Purification kit (MGmed), and sequenced with the ABI 3730xl Analyzer, using the ABI BigDye Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems, Foster City, CA, USA). The obtained sequences were manually determined and aligned by using MAFFT with Geneious Prime 2019.2.3 (Biomatters Ltd., Auckland, NZ). The DNA sequences generated in this study have been deposited in GenBank (Table
List of
Taxon | Locality | Voucher information | GenBank number | |||
---|---|---|---|---|---|---|
|
Kazakhstan: Burlinsky, Zharsuat |
|
|
|
|
|
|
Mongolia: khovd, Munkhkhairkhan, Khuren khesuu |
|
|
|
|
|
Mongolia: khovd, Munkhkhairkhan |
|
|
|
|
|
|
|
South Korea: Gyeongbuk, Ulleungdo, Nari |
|
|
|
|
|
South Korea: Gyeongbuk, Ulleungdo, Nari |
|
|
|
|
|
|
|
South Korea: Gyeonggi, Yangju, Jangheung |
|
|
|
|
|
South Korea: Gyeonggi, Yangju, Jangheung |
|
|
|
|
|
|
|
Mongolia: Ulaanbaatar, Uvor Gunt davaa |
|
|
|
|
|
Mongolia: Govi-Altai |
|
|
|
|
|
|
|
Mongolia: Ulaanbaatar, Sanzai |
|
|
|
|
|
Mongolia: Tuv, Mungunmorit |
|
|
|
|
|
|
|
Russia: Primorskiy kray, Terneysky |
|
|
|
|
|
Russia: Primorskiy kray, Terneysky |
|
|
|
|
|
|
Russia: Primorskiy kray, Khasansky, Schultz |
|
|
|
|
|
|
Russia: Primorskiy kray, Khasansky, Schultz |
|
|
|
|
|
|
Russia: Primorskiy kray, Sukhanovka |
|
|
|
|
|
|
Russia: Primorskiy kray, Sukhanovka |
|
|
|
|
|
|
Russia: Primorskiy kray, Khasansky |
|
|
|
|
|
|
Russia: Primorskiy kray, Khasansky |
|
|
|
|
|
|
South Korea: Gangwon, Goseong |
|
|
|
|
|
|
South Korea: Gangwon, Goseong |
|
|
|
|
|
|
South Korea: Gangwon, Gangneung |
|
|
|
|
|
|
South Korea: Gangwon, Gangneung |
|
|
|
|
|
|
South Korea: Gangwon, Goseong |
|
|
|
|
|
|
South Korea: Gangwon, Goseong |
|
|
|
|
|
|
South Korea: Gangwon, Goseong |
|
|
|
|
|
|
South Korea: Gangwon, Gangneung |
|
|
|
|
|
|
|
South Korea: Gyeongbuk, Bonghwa, Cheongnyangsan |
|
|
|
|
|
South Korea: Gyeongbuk, Bonghwa, Cheongnyangsan |
|
|
|
|
|
|
China: Jilin, Erdaobaihe |
|
|
|
|
|
|
China: Jilin, Erdaobaihe |
|
|
|
|
|
|
China: Jilin, Linjiang |
|
|
|
|
|
|
China: Jilin, Linjiang |
|
|
|
|
|
|
|
South Korea: Gangwon, Goseong |
|
|
|
|
|
|
China: Jilin, Erdaobaihe |
|
|
|
|
|
China: Jilin, Erdaobaihe |
|
|
|
|
|
The phylogenetic analyses were conducted using Maximum Likelihood (
Our data indicate that several morphological characters are of taxonomic utility in
Comparison of major characters of
Character |
|
|
|
|
|
|
---|---|---|---|---|---|---|
Rhizome | oblique to horizontal | horizontal | horizontal | oblique | horizontal | |
Leaf sheath | exposed | buried | buried | exposed | exposed | |
Leaf blade | texture | fleshy, glaucous | leathery, lustrous | leathery, lustrous | fleshy, glaucous | fleshy, glaucous |
length (cm) | 19.5–38.0 | 20.0–45.0 | 15–30.0 | 11.4–24.5 | 23.0–45.0 | |
width (mm) | 3.8–13.0 | 4.0–10.0 | 1.5–4.0 | 2.8–4.5 | 5.0–15.0 | |
Scape | cross-section | rhomboid | flattened-winged | rhomboid to subterete | subterete | subterete |
length (cm) | 23.4–49.0 | 33.0–65.0 | 10.0–40.0 | 11.7–20.5 | 25.8–70.0 | |
diameter (mm) | 2.5–5.6 | 4.0–5.1 | 1.5–2.5 | 1.5–1.6 | 3.0–5.5 | |
Pedicel | length (mm) | 9.8–11.2 | 6.0–12.4 | 7.6–11.1 | 8.7–11.1 | 8.0–13.0 |
Perianth | shape | semi-radially spreading | campanulate | campanulate | radially spreading | radially spreading |
color | light purple | reddish purple | strong purple or pale purple | pale purple | pale purple | |
Inner tepal | shape | elliptical to ovately-elliptical | ovately-elliptical | ovately-elliptical | elliptical | elliptical |
length (mm) | 5.2–7.2 | 4.0–6.8 | 3.9–6.3 | 4.0–4.8 | 4.3–6.4 | |
width (mm) | 3.4–4.5 | 2.0–4.2 | 2.2–3.4 | 1.2–1.9 | 1.8–2.9 | |
Outer tepal | Shape | ovately-elliptical | ovately-elliptical | ovately-elliptical | ovate-oblong | ovately-elliptical |
length (mm) | 4.8–6.1 | 3.1–5.0 | 2.9–5.2 | 3.7–4.6 | 3.1–5.2 | |
width (mm) | 2.1–3.7 | 1.3–3.0 | 1.1–2.3 | 1.1–1.7 | 1.1–2.5 | |
Filament | exsertion | exserted | exserted | exserted | non-exserted | exserted |
length (mm) | 6.2–8.4 | 5.3–8.8 | 5.0–7.0 | 3.2–4.4 | 4.6–6.9 | |
Inner filament | margin | entire | entire | entire | entire | entire or 2-toothed |
shape | narrowly triangular | subulate | subulate | broadened for ca. 1/2 in length | broadened for ca. 1/2 in length | |
Anther | length (mm) | 2.2–2.5 | 1.7–2.2 | 1.7–2.0 | 1.3–1.4 | 1.5–2.0 |
width (mm) | 0.9–1.1 | 0.7–1.0 | 0.6–0.8 | 0.6–0.8 | 0.7–0.9 | |
Ovary | length (mm) | 3.2–3.8 | 2.0–3.4 | 1.8–2.8 | 2.1–2.4 | 2.4–3.1 |
width (mm) | 3.2–3.7 | 1.8–3.1 | 1.5–2.7 | 1.8–2.0 | 2.6–2.8 | |
Capsule | length (mm) | 5.4–5.6 | 5.0–5.3 | 4.8–5.1 | 3.5–3.7 | 4.5–5.5 |
width (mm) | 5.6–5.8 | 4.5–5.0 | 4.5–5.0 | 3.6–4.0 | 4.5–5.6 | |
Seed | length (mm) | 3.7–3.8 | 3.0–3.3 | 2.8–3.2 | 2.0–2.2 | 3.0–3.5 |
width (mm) | 2.4–2.6 | 2.0–2.2 | 2.0–2.3 | 1.3–1.5 | 2.2–2.4 | |
Flowering season | late Sep. to Oct. | Aug. to Sep. | Jul. to Aug. | May to Jul. | Jul. to Aug. | |
Chromosome number (2n) | 2n = 32 | 2n = 16, 32 | 2n = 16, 32 | 2n = 16 | 2n = 32 |
Comparative photographs of the inflorescence, cross-section of leaf and scape, flower, and tepal and filament arrangement of
Principal components analysis plot of five
The somatic chromosome numbers of
Mitotic metaphase chromosomes and their voucher plants of
Total combined dataset of four chloroplast regions was comprised of 93 samples, including 58 from chloroplast genome. The aligned dataset was 6,046 bp long (4,086 bp in newly sequenced samples) with 556 parsimony-informative site and 4,881 constant site. The dataset consists of
Our phylogenetic tree revealed a similar topology, not showing distinct monophyly, to the previous study (
1a | Leaf sheaths buried under ground; leaf blades leathery, lustrous; perianths campanulate; inner tepals ovate-elliptical; inner filaments entire at margin |
|
1b | Leaf sheaths exposed above ground; leaf blades fleshy, glaucous; perianths radially spreading; inner tepals elliptical; inner filaments entire or toothed at margin |
|
2a | Leaf blades 4–10 mm wide; scapes clearly flattened-winged in cross-section |
|
2b | Leaf blades 1.5–4 mm wide; scapes rhomboid in cross-section |
|
3a | Leaf blades 2.8–4.5 mm wide; scapes subterete in cross-section, 11.7–20.5 mm long; inner tepals 4.0–4.8 mm long, 1.2–1.9 mm wide; outer tepals 3.7–4.6 mm long, 1.1–1.7 mm wide; filaments non-exserted, 3.2–4.4 mm long; capsules 3.5–3.7 mm long, 3.6–4 mm wide; seeds 2.0–2.2 mm long, 1.3–1.5 mm wide; flowering from May to July (2 |
|
3b | Leaf blades 3.8–15 mm wide; scapes subterete to rhomboid in cross-section, 23.4–70 mm long; inner tepals 4.3–7.2 mm long, 1.8–4.5 mm wide; outer tepals 3.1–6.1 mm long, 1.1–3.7 mm wide; filaments exserted, 4.6–8.4 mm long; capsules 4.5–5.6 mm long, 4.5–5.8 mm wide; seeds 3.0–3.8 mm long, 2.2–2.6 mm wide; flowering from July to October (2 |
|
4a | Scapes rhomboid in cross-section; perianths light purple; inner filaments narrowly triangular, entire at margin; inner tepals 3.4–4.5 mm wide; ovaries 3.2–3.7 mm wide; flowering from late September to October |
|
4b | Scapes subterete in cross-section; perianths pale purple; inner filaments broadened for ca. 1/2 in length, entire or 2-toothed at margin; inner tepals 1.8–2.9 mm wide; ovaries 2.6–2.8 mm wide; flowering from July to August |
|
This new species is morphologically similar to
South Korea. Gyeongbuk: Ulleung-gun, Namyang,
Herbs hermaphroditic. Rhizomes clearly elongated, thick and branched, oblique to horizontal, 14.8–55.4 mm long. Bulbs clustered, cylindrically conical, 9.6–15 mm in diam.; tunics membranous, smooth, white. Leaves 4–9; sheaths slightly exposed above ground, 4–7.8 cm long; blades ascending, slightly tortuous, linear, flat and solid in cross-section, flesh, 19.5–38 cm × 3.8–13 mm, apex obtuse to rounded. Scapes rhomboid and solid in cross-section, drooping before flowering, 23.4–49 cm × 2.5–5.6 mm. Inflorescences umbellate, subglobose, 23–41.5 × 37–53 mm, 48–113 flowered; pedicels terete, subequal in length, 9.8–11.2mm long; bracts 3.2–5 mm long. Flowers bisexual; perianth semi-radially spreading, light purple; inner tepals longer than outer ones, elliptical, apex obtuse, 5.2–7.2 × 3.4–4.5 mm; outer tepals ovately elliptical, apex obtuse, 4.8–6.1 × 2.1–3.7 mm; filaments exserted, 6.2–8.4 mm long, margin entire; inner filaments narrowly triangular; anthers elliptical, reddish, 2.2–2.5 × 0.9–1.1 mm long; ovary obovoid, reddish, 3.2–3.8 × 3.2–3.7 mm, ovules 2 per locule; style terete, exserted; stigma smooth. Capsules cordiform, trigonous, 5.4–5.6 × 5.6–5.8 mm. Seeds oval, semi-circular in cross-section, 3.7–3.8 × 2.4–2.6 mm.
Flowering from late September to October; fruiting from late October to November.
Endemic to South Korea (Ulleung-do Island; Fig.
Distribution map of
The specific epithet, “
The Korean name of the new species is “Du-me-bu-chu (두메부추)”.
The new species is endemic to Ulleungdo Island, and usually grows along the coast at altitudes of -23–171m a.s.l. From the present study, the extent of occurrence (
Phylogenetic tree of
Russia (Far East), specimen without collection date and number (Holotype: B photo!).
China. Jilin: Gyoha, Ipbeopsan, 2 Sep. 2006,
Russia (Siberia, location in doubt). Type specimen not designated (protologue).
China. Jilin: Helong, 8 Sep. 2007,
South Korea. Gangwon: Inje, Wolhaksam-ri, 26 May 1979,
This species was originally published as a variety of
South Korea. Gangwon: Inje, 26 May 1979,
Russia. From Siberia (forebaical region),
China. Heilongjiang: ?, 1959,
Research for this article was supported by a research project (A study on the floral morphology of Korean