Corresponding author: Matt A.M. Renner (
Academic editor: Lyubomir Penev
Molecular data from three chloroplast markers resolve individuals attributable to
Crypsis is thought to be a widespread phenomenon in bryophytes (
The genus
Relationships between seven subgenera identified within
Thirty one and seventeen species of
Distribution of
Morphological variation expressed by individuals included in this study, showing variation in shoot size, branching pattern, and lobule shape. All species represented by the individuals shown belong to the
Morphologically circumscribed bryophyte species tend to have broader geographical distributions than angiosperm species (
Although cryptic haplotype diversity was detected within
Sampling for DNA was based on material collected haphazardly throughout the geographical range reported for
Clean shoot tips comprising the meristem, immature leaves, and one or two nearly mature leaves were excised from each specimen until approximately 25–50 mm2 of cleaned material was obtained depending on plant size. Study specimens were either stored on silica gel or rapidly air dried from wild collected material to ensure plant material remained green and free of fungus.
Voucher information and GenBank accession numbers for specimens included in the molecular dataset. All ‘MR’ isolates were newly generated for this study.
|
|
|
|
|
|
---|---|---|---|---|---|
|
T. Pocs 02102/AA EGR | ND_227 | - |
|
|
|
Australia, Norfolk Island H Streimann 32084A CANB650459 | MR_75 | - | - |
|
|
S. & T. Pocs 04011/G EGR | ND_222 | - |
|
|
|
S.R. Gradstein 9448 GOET | ND_088 | - |
|
|
|
T. Yamaguchi 1731 BR | ND_339 | - | - |
|
|
T. Pocs 90113/AH EGR | ND_229 | - |
|
|
|
A. chafer-Verwimp & Verwimp 26039 Herb. Schafer-verwimp | ND_078 | - |
|
|
|
Australia, Victoria M.A.M. Renner 5114 NSW893115 | MR_1 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5138 NSW875865 | MR_10 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5139 NSW875866 | MR_11 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5142 NSW875928 | MR_12 |
|
|
- |
|
Australia, Victoria M.A.M. Renner 5143 NSW875940 | MR_13 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5144 NSW875941 | MR_14 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5145 NSW875942 | MR_15 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5150 NSW875947 | MR_16 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5162 NSW875951 | MR_17 |
|
- |
|
|
Australia, Victoria M.A.M. Renner 5164 NSW875953 | MR_18 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5115 NSW893116 | MR_2 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5205 NSW893128 | MR_22 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5118 NSW893119 | MR_3 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5127 NSW909241 | MR_4 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5129 NSW909251 | MR_5 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6142 NSW895444 | MR_50 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6148 NSW895456 | MR_51 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6168 NSW895494 | MR_52 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6230 NSW895690 | MR_57 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6239 NSW896176 | MR_58 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6241 NSW896177 | MR_59 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5130 NSW909252 | MR_6 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5131 NSW909254 | MR_7 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5133 NSW875860 | MR_8 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5135 NSW875862 | MR_9 | - | - |
|
|
AK280485 AK | ND_096 | - |
|
- |
|
J.A. Curnow 5635 CBG | ND_119 | - |
|
|
|
H. Streimann 53505 CBG | ND_121 | - |
|
|
|
J.A. Curnow 5638 CBG | ND_124 | - |
|
|
|
D. Glenny CHR559976 CHR | ND_210 | - |
|
|
|
B. Shaw 6089 DUKE | ND_299 | - |
|
|
|
T. Pocs NY8016 NY | ND_161 | - |
|
- |
|
T. Pocs 88110/AR E | ND_178 | - |
|
- |
|
N. Ohnishi H3196644 H | ND_001 | - |
|
|
|
Australia, Victoria M.A.M. Renner 5176 NSW875959 | MR_19 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5177 NSW875960 | MR_20 |
|
|
|
|
Australia, Victoria M.A.M. Renner 5204 NSW893126 | MR_21 |
|
|
|
|
Australia, New South Wales M.A.M. Renner 5246 NSW875783 | MR_23 |
|
|
|
|
Australia, New South Wales M.A.M. Renner 5257 NSW875805 | MR_24 |
|
|
|
|
Australia, New South Wales M.A.M. Renner 5288 NSW875835 | MR_27 |
|
|
|
|
Australia, New South Wales M.A.M. Renner 5303 NSW877190 | MR_28 |
|
|
|
|
Australia, New South Wales M.A.M. Renner 5868 NSW898654 | MR_29 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 5939 NSW895271 | MR_33 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 6016 NSW909416 | MR_37 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 6025 NSW909425 | MR_40 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 6027 NSW909430 | MR_41 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 6032 NSW909436 | MR_42 |
|
|
|
|
Australia, Western Australia E.D. Cooper 09/067 NSW970847 | MR_72 |
|
|
|
|
Australia, Western Australia E.D. Cooper 09/068 NSW970854 | MR_73 | - |
|
|
|
Australia, Western Australia E.D. Cooper 09/142 NSW970856 | MR_74 | - | - |
|
|
Australia, New South Wales EA Brown 89/35 NSW436068 | MR_76 |
|
|
|
|
A. Schafer-Verwimp & Verwimp 14336 Herb. Schafer-verwimp | ND_053 | - |
|
|
|
H. Streimann 54341 CBG | ND_127 | - |
|
|
|
B. Shaw 6511 DUKE | ND_293 | - |
|
|
|
B. Shaw DUKE | ND_294 | - |
|
|
|
B. Shaw 6619 DUKE | ND_295 | - |
|
|
|
B. Shaw DUKE | ND_297 | - |
|
|
|
B. Shaw 6209 DUKE | ND_298 | - |
|
|
|
B. Shaw DUKE | ND_300 | - |
|
|
|
B. Shaw DUKE | ND_301 | - |
|
|
|
N. Ohnishi HIRO225 GOET | ND_042 | - |
|
- |
|
A. Schafer-Verwimp & Verwimp 25734 Herb. Schafer-verwimp | ND_018 | - |
|
|
|
A. Schafer-Verwimp & Verwimp 23835 Herb. Schafer-verwimp | ND_045 | - |
|
|
|
J.A. Curnow 4525 CBG | ND_126 | - |
|
- |
|
B. Shaw F915 DUKE | ND_311 | - |
|
- |
|
T. Koponen H3187494 H | ND_004 | - |
|
- |
|
A. Schafer-Verwimp & M. Preussing 23532 Herb. Schafer-verwimp | ND_068 | - |
|
|
|
I. Holz & Franzaring CH0060 GOET | ND_026 | - |
|
|
|
Australia, Tasmania M.A.M. Renner 5916 NSW909267_1 | MR_30 |
|
|
- |
|
Australia, Tasmania M.A.M. Renner 5916 NSW909267_2 | MR_31 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 5923 NSW895246 | MR_32 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 5940 NSW895272 | MR_34 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 5989 NSW909286 | MR_35 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 5998 NSW909293 | MR_36 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 6023 NSW909423 | MR_38 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 6024 NSW909424 | MR_39 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 6036 NSW909452 | MR_43 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 6048 NSW909482 | MR_44 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6076 NSW895351 | MR_45 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6127 NSW895397 | MR_48 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6137 NSW895439 | MR_49 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6180 NSW895508 | MR_53 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6183 NSW895511 | MR_54 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6227 NSW895686 | MR_56 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6244 NSW896179 | MR_60 |
|
|
|
|
New Zealand, North Island P.J. de Lange NC16 NSW970835 | MR_79 |
|
|
|
|
Australia, Tasmania M.A.M. Renner 5936 NSW895267 | MR_90 |
|
|
|
|
AK254565 AK | ND_107 | - |
|
- |
|
AK280339 AK | ND_110 | - |
|
|
|
M.A.M. Renner AK280588 AK | ND_111 | - |
|
|
|
A. Schafer-Verwimp & M. Preussing 23330/A Herb. Schafer-verwimp | ND_058 | - |
|
|
|
S. Churchill, M. Serrano et al. MO23708 MO | ND_148 | - |
|
|
|
T. Pocs, R.E. Magill & A. Rupf 9288/R EGR | ND_234 | - |
|
|
|
A. Schafer-Verwimp & M. Preussing 23250/A Herb. Schafer-verwimp | ND_074 | - |
|
|
|
A. Schafer-Verwimp, J. Heinrichs, R.A. Wilson & S.O. Yandun 24422 GOET | ND_072 | - |
|
|
|
B. Shaw 6209 DUKE | ND_323 | - |
|
|
|
T. Pocs s.n. EGR | ND_240 | - |
|
|
|
I. Holz CR000493 GOET | ND_091 | - |
|
|
|
U. Drehwald NY970175 NY | ND_154 | - |
|
|
|
T. Pocs s.n. EGR | ND_215 | - |
|
|
|
S. Ingram & K. Ferrell-Ingram Ingram1765 | ND_060 | - |
|
- |
|
D. Glenny CHR571846 CHR | ND_212 | - | - |
|
|
S.R. Gradstein 9443 GOET | ND_090 | - |
|
|
|
M.A.M. Renner AK282969 AK | ND_098 | - |
|
|
|
J.A. Curnow & H. Streimann 3689 CBG | ND_120 | - |
|
|
|
Hodgetts M2668a E | ND_185 | - |
|
|
|
N. Devos & A. Vanderpoorten DV003 DUKE | ND_281 | - |
|
|
|
M.J. Lyon DB12895 MO | ND_015 | - |
|
|
|
Australia, New South Wales M.A.M. Renner 5275 NSW875821_1 | MR_26 |
|
|
|
|
Australia, New South Wales M.A.M. Renner 5275 NSW875821_2 | MR_85 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6356 NSW896812 | MR_89 |
|
|
|
|
A. Schafer-Verwimp & Verwimp 18757/A Herb. Schafer-verwimp | ND_076 | - | - |
|
|
M. Higuchi 1198 BR | ND_353 | - |
|
|
|
S. Churchill, M. Decker & F. Morgo MO22187 MO | ND_142 | - |
|
|
|
N. Devos s.n. DUKE | ND_267 | - |
|
|
|
N. Salazar DB3609 GOET | ND_012 | - |
|
|
|
M. Mizutani 14255 DUKE | ND_137 | - |
|
|
|
A. Schafer-Verwimp & Verwimp 25732/A Herb. Schafer-verwimp | ND_063 | - |
|
|
|
T. Pocs s.n. EGR | ND_238 | - |
|
|
|
S.R Gradstein & G. Dauphin DB12894 GOET | ND_007 | - |
|
|
|
A. Szabo 9614/DV EGR | ND_232 | - |
|
|
|
T. Pocs 90103/AE EGR | ND_233 | - |
|
|
|
A. Schafer-Verwimp & Verwimp 17767 Herb. Schafer-verwimp | ND_081 | - |
|
|
|
A. Schafer-Verwimp & M. Preussing 23204 Herb. Schafer-verwimp | ND_036 | - |
|
|
|
Australia, Queensland M.A.M. Renner 6489 NSW897206 | MR_80 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6288 NSW896672 | MR_81 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6296 NSW896685 | MR_82 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6486 NSW897201 | MR_83 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6497 NSW909664 | MR_84 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6282 NSW896665 | MR_86 |
|
|
|
|
M.A.M. Renner AK280299 AK | ND_108 | - |
|
|
|
K.R. Wood NY9604 NY | ND_166 | - |
|
|
|
B. Allen NY11935 NY | ND_160 | - |
|
|
|
Australia, Queensland M.A.M. Renner 6275 NSW896419 | MR_64 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6276 NSW896657 | MR_65 |
|
- |
|
|
Australia, Queensland M.A.M. Renner 6487 NSW897204 | MR_66 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6504 NSW909497 | MR_67 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6505 NSW909500 | MR_68 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6506 NSW909501 | MR_69 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6507 NSW909502 | MR_70 |
|
|
|
|
A. Schafer-Verwimp & M. Preussing 23447 Herb. Schafer-verwimp | ND_020 | - |
|
|
|
Australia, Queensland M.A.M. Renner 2277 NSW909661 | MR_87 |
|
|
|
|
Australia, Queensland M.A.M. Renner 6510 NSW898712 | MR_88 |
|
|
|
|
B. Shaw 4874 DUKE | ND_135 | - |
|
|
|
W.B. Schofield 115550 DUKE | ND_133 | - |
|
- |
|
J.A. Curnow 3664 CBG | ND_116 | - |
|
|
|
M. Mizutani NY15272 NY | ND_158 | - |
|
- |
|
M.A.M. Renner CHR555962 CHR | ND_211 | - |
|
- |
|
M.A.M. Renner AK280391 AK | ND_103 | - |
|
|
|
J. Hyvonen DB3600 GOET | ND_011 | - |
|
|
|
S. Churchill, M. Serrano et al. MO23444 MO | ND_150 | - |
|
|
|
B. Shaw F956 DUKE | ND_315 | - |
|
|
|
W.B. Schofield 115792 DUKE | ND_131 | - |
|
|
|
H. Streimann 63817 EGR | ND_219 | - |
|
|
|
T. Pocs, E.M. Kungu & A. Szabo 9230/S EGR | ND_225 | - |
|
|
|
J.A. Curnow 3846 CBG | ND_118 | - |
|
|
|
Australia, Tasmania M.A.M. Renner 5933 NSW895261 | MR_77 |
|
|
|
|
M.A.M. Renner AK280205 AK | ND_102 | - |
|
|
|
M. Burghardt DB21422 GOET | ND_092 | - |
|
|
|
T. Pocs s.n. EGR | ND_220 | - |
|
|
|
S. & T. Pocs 03281/C EGR | ND_228 | - |
|
|
|
Australia, Queensland M.A.M. Renner 2271 NSW885024 | MR_91 |
|
|
|
|
A. Schafer-Verwimp & Verwimp 18053 Herb. Schafer-verwimp | ND_075 | - |
|
|
|
A. Schafer-Verwimp & M. Preussing 23443/A Herb. Schafer-verwimp | ND_019 | - |
|
|
|
T. Pocs s.n. EGR | ND_235 | - |
|
|
|
T. Arts R…U52/24 BR | ND_346 | - |
|
|
|
Australia, New South Wales M.A.M. Renner 5265 NSW875811 | MR_25 | - |
|
- |
|
New Zealand, South Island M.A.M. Renner 6082 NSW895357 | MR_46 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6092 NSW895367 | MR_47 |
|
|
|
|
New Zealand, South Island M.A.M. Renner 6222 NSW895673 | MR_55 |
|
|
- |
|
New Zealand, South Island M.A.M. Renner 6259 NSW896393 | MR_61 |
|
|
|
|
New Zealand, North Island M.A.M. Renner 6265 NSW896405 | MR_62 |
|
|
|
|
New Zealand, North Island M.A.M. Renner 6266 NSW896409 | MR_63 | - | - |
|
|
New Zealand, North Island P.J. de Lange 10167 AK327986 | MR_71 |
|
|
|
|
New Zealand, North Island P.J. de Lange NC14 NSW970841 | MR_78 |
|
|
|
|
M.A.M. Renner AK280392 AK | ND_099 | - |
|
|
|
AK286375 AK | ND_100 | - |
|
|
|
CHR525056 CHR | ND_204 | - |
|
|
|
U. Drehwald 970175 BR | ND_352 | - |
|
|
|
I. Holz & Schafer-Verwimp DB13093 GOET | ND_030 | - |
|
|
|
B. Shaw 6189 DUKE | ND_321 | - |
|
|
|
M.A.M. Renner AK280184 AK | ND_101 | - |
|
|
|
P.G. Davison & M.L. Hicks 2946 DUKE | ND_129 | - |
|
- |
|
A. Schafer-Verwimp, J. Heinrichs, R.A. Wilson & S.O. Yandun 24230 Herb. Schafer-verwimp | ND_022 | - |
|
|
|
Vanuatu, E.A. Brown s.n. NSW971057 | MR_92 |
|
|
|
|
A.L. Ilkiu-Borges, S.R. Gradstein, K.T. Yong & M. Ponniah DB16663 GOET | ND_055 | - | - |
|
|
T. Koponen H3187760 H | ND_003 | - |
|
- |
|
S.R. Hill NY21274 NY | ND_167 | - |
|
|
|
A. Vanderpoorten AVW857 LG | ND_014 | - |
|
|
|
A. Schafer-Verwimp & Verwimp 26018 Herb. Schafer-verwimp | ND_057 | - |
|
|
Total genomic DNA was extracted using the DNeasy Plant Minikit (QIAGEN Pty Ltd, Sydney Australia). Three chloroplast markers were sequenced, (1) the
Primers used in this study for amplification and sequencing of three chloroplast DNA regions.
|
|
|
|
|
---|---|---|---|---|
ACATCKARTACKGGACCAATAA | Forward |
|
||
AACACCAGCTTTRAATCCAA | Reverse |
|
||
A50272 | ATTTGAACTGGTGACACGAG | Forward |
|
|
B49317 | CGAAATCGGTAGACGCTACG | Reverse |
|
|
ACCCGCATCGTTAGCTTG | Forward |
|
||
GCGGGTATAGTTTAGTGG | Reverse |
|
For each DNA region, forward (5’–3’) and reverse (3’–5’) sequences were assembled and checked for inaccurate base calling using Geneious (
Maximum parsimony
Maximum likelihood
Bayesian analysis was performed with a hybrid version of MrBayes ( Akaike Information Criterion
Specimens of
Stem transverse sections were prepared by hand from primary shoots, with sections taken from three different shoots for each individual, and slide mounted in water for observation. Dissections of female bracts, gynoecia, and archegonia were by hand with the aid of a pair of Inox #5 ‘Biologie’ tweezers and slide mounted in water. Perianth longitudinal sections were also prepared by hand, with two or three perianths from a selection of individuals examined for each species depending on availability, and slide mounted in water for examination.
Observations of species ecology were made during fieldwork for various purposes in New Zealand and Australia from 2000 to 2013. Geographic data was drawn from digitised collections, in particular AVH, and from geo-referenced specimens.
Capsule and perianth lengths for three specimens of
Species described here are formal placeholders for hypotheses explaining the distribution of character data from multiple sources, including morphology, ecology, geography, and molecular sequence data among individuals (see
We sampled 62 and 25 individuals of
All data partitions converged on nearly identical topologies for supported clades, with no significant disagreement. All three partitions recover the subgeneric framework resolved in
Majority rule phylogram from posterior probability distribution sampled by MrBayes showing the phylogeny of
The six individuals of
Majority Rule tree from posterior probability distribution sample taken by MrBayes, shown as a modified proportional tree, with some branch lengths shortened, for presentation purposes, with morphological groups identified. Tree topology, rather than branch length is emphasized in this tree, the branches are not to any scale. For branch lengths proportional to substitution rate refer to
Relationships at the base of subg.
The seven individuals of
Other species of the
The name
Most published examples of cryptic diversity within bryophytes come from the northern hemisphere in particular Europe and North America (e.g.
In liverworts, lineage diversity suggestive of cryptic species in the Australasian
There may be good reason for the persistent failure by traditional approaches to recognise instances of crypsis and semi-crypsis. Investigation of patterns of morphological variation within species belonging to the
Within the
Variation and co-occurrence in sympatry complicate determination and may have contributed to the generally poor standard of identification in herbarium material. For this study 533 named specimens of
Actual identities of 533 herbarium specimens determined as
1 | |
1 | |
|
2 |
|
11 |
|
190 |
|
8 |
|
1 |
|
125 |
|
1 |
|
2 |
|
3 |
|
1 |
|
2 |
|
12 |
|
1 |
|
12 |
|
2 |
|
3 |
2 | |
1 | |
1 | |
5 | |
|
127 |
10 | |
|
7 |
|
2 |
Total | 533 |
The phylogenetic breadth of molecular phylogenetic investigations that have identified cryptic and semi-cryptic diversity, coupled with a mechanism explaining complicated, and often confusing, patterns of morphological variation make the extrapolation that all bryophyte groups contain overlooked diversity a fairly safe inference. Many studies result in reinstatement of synonyms (
Our study suggests that within
The taxonomically pervasive, indeed indiscriminate, distribution of cryptic and semi-cryptic species suggests that estimates of global diversity for liverworts revised upward of 10,000 species might not be unreasonable. New Zealand, one of the regions involved in the
The identification of cryptic species, and reconstruction of spatial structure of genetic diversity informs biogeography and evolutionary ecology. In bryophytes, morphologically circumscribed species generally have larger distribution ranges than angiosperm species (
Morphological similarity and continuity between
In
Considerable lineage diversity was recovered within Australian
All entities within the
Despite its apparent rarity long-distance dispersal has contributed to diversity within the
The traditional view that morphological evolution in bryophytes takes place over millions, if not tens of millions of years, has been confirmed in a couple of dated phylogenetic studies, including the moss
Artificial key distinguishing species belonging to the
1 | Leaf-lobe cell surface roughened, verrucose. Lobules one quarter the lobe area on primary shoots, quadrate, with ampliate interior margin. Shoot systems regularly pinnate and subdimorphic with secondary shoots smaller than primary, and with more rectangular lobules whose antical margin may be reflexed near the stem insertion; plants from exposed situations may comprise mostly secondary shoots and the regularly pinnate branching pattern may not be apparent. Stems relatively massive 190–250 µm diameter, with cortical cells in a single tier of 30–50 rows; cell walls brown pigmented throughout; cortical cell walls heavily and continuously thickened, at times constricting the cell lumen; medulla cells in 80–110 rows, cell walls heavily thickened with coarse nodular trigones that become confluent, and constrict the cell lumen. Leaf insertion exceeding dorsal stem mid-line, insertion lines interlocking over two dorsal cortical cell rows, dorsal leaf-free strip absent. Perianths with low basal stem perigynium. Plants milky yellow-green when fresh |
|
– | Leaf-lobe cell surface smooth, either unornamented or with low dome-shaped papillae. Lobules one eighth to one quarter the lobe area, shape on primary shoots various including rhombiform, tullate, quadrate and oblong with or without an ampliate interior margin. Shoot systems regularly pinnate with subdimorphic branching, or irregular with pseudodichotomous branches in association with gynoecia. Stems not massive, c. 100–200 µm diameter with cortical cells in a single tier of up to 35 rows, cell wall pigmentation various, unpigmented throughout, brown-pigmented in cortical cell walls only or brown pigmented throughout, cell wall thickening various, secondary thickening generally absent from medulla cell walls except |
2 |
2 | Female bracts in one and a half or two pairs. Lobules rhombic to trullate, inner lobule margin free for up to two thirds its length, free portion not ampliate, not extending across stem beyond insertion line, apex narrowly rounded to acute, free exterior margin straight, occasionally with a small knee above the lobe-lobule junction, margins entire; leaf-lobes weakly falcate. Stem anatomy with all cortical cell walls heavily and almost continuously thickened and brown pigmented, medulla walls with yellow-brown to brown pigmented secondary thickenings and nodular trigones that are confluent across medial walls |
|
– | Female bracts in one pair. Lobules various, rhombic, quadrate, longitudinally rectangular; inner lobule margin free for up to one half its length, free portion ampliate or not, often extending across stem beyond insertion line, apex various, obtuse to acute, free exterior margin straight or curved, knee present or not, margins entire to crenulate; leaf-lobes not falcate to falcate. Stem anatomy with external cortical cell wall continuously thickened and brown pigmented, internal cortical cell walls unthickened or discontinuously thickened, unpigmented or with less intense pigmentation, medulla walls without pronounced secondary thickening and unpigmented (but brown pigmented in |
3 |
3 | Perianth mouth flared; shoot systems pseudodichotomously branched. Medulla cells of stem with bulging trigones at cell junctions. Leaf-lobules trapeziform when well developed with exterior and interior margins nearly parallel, margins crenulate; Female bracts relatively small, subisolobous and closely overlapping |
|
– | Perianth mouth not flared; shoot systems pinnately branched, with additional pseudodichotomous branches in female individuals. Medulla cells of stem without bulging trigones at cell junctions. Leaf-lobules rhomboid to quadrate, margins entire or crenulate. Female bracts various, not subisolobous, closely overlapping or not | 4 |
4 | Dorsal leaf-free strip present. Leaf lobes tending to lay in plane with the stem (not always the case) and the stem usually visible between the leaf lobes in dorsal view. | 5 |
– | Dorsal leaf-free strip absent. Leaf lobes tending to be obliquely patent and lay over the stem, obscuring the stem surface in dorsal view | 7 |
5 | Leaf-lobes oblong-elliptic, with a straight postical margin held perpendicular to the stem. Leaf lobes fragmenting on mature shoot sectors. Female bract lobes oblong-elliptic, widely divergent. Leaf-lobules rhombic, with apex lying close to the stem margin |
|
– | Leaf-lobes rotund to ovate, with a curved postical margin. Leaf lobes not fragmenting. Female bract lobes elliptic-ovate, overlapping. Leaf lobules rhombic to quadrate, with apex lying close to the stem margin or away from it | 6 |
6 | Lobules quadrate to rhombic when small and large, one eighth to one sixth the lobe area; keel apex and postical lobe margin with shallow notch; interior lobule margin free for one third its length, free portion weakly ampliate in small stature lobules to moderately ampliate on large stature lobules, extending at most half way across the ventral stem surface; acroscopic margin S-shaped (typical in situ) to straight (when flattened), apical portion inclined toward stem, not exceeding (lying antical to) the lobule apex; apex obtuse to acute; free exterior margin straight curved, occasionally with a small knee above the lobe-lobule junction; margins plane, entire or shallowly repand; lobe-lobule junction slightly antical to, or level with, the acroscopic end of stem insertion |
|
– | Lobules quadrate when small to oblong, one twelfth to one sixth the lobe area, keel apex and postical lobe margin flush; interior lobule margin free for one fifth to one quarter its length, free portion not ampliate in small stature lobules to moderately ampliate on large lobules, extending at most half way across the ventral stem surface; acroscopic margin S-shaped, apical portion perpendicular to stem, in large lobules exceeding (lying antical to) the lobule apex; apex obtuse to apiculate; free exterior margin straight, margins plane; lobe-lobule junction well postical to the acroscopic end of stem insertion |
|
7 | Lobules quadrate, one quarter the lobe area, apex acute, interior margin free for one quarter to one third its length, ampliate over stem margin; keel curved, running seamlessly into leaf-lobe outline, lobe margins crenulate due to differential thickenings on medial external cell walls |
|
– | Lobules rhombic, one sixth the lobe area, apex obtuse, interior margin free for one fifth to one third its length, ampliate over the stem margin or not; keel curved, not running seamlessly into leaf-lobe outline, leaf-lobes weakly to strongly falcate, lobe margins crenulate due to differential thickenings on medial external walls or by bulging cells | 8 |
8 | Leaf-lobe cell surfaces unornamented, lobe margins crenulate due to bulging cells. Leaf lobes falcate |
|
– | Leaf-lobe cell surfaces with a single low dome-shaped papilla over each cell, lobe margins crenulate due to differential thickenings on medial external cell walls. Leaf lobes at most weakly falcate |
|
Australia: Norfolk Island: Mount Pitt Reserve, Filmy Fern Trail, off Selwyn Pine Road,
Within the
[From CANB650459] Forming diffuse patches of small shoots, or mixed with other bryophytes, brown in herbarium; shoot systems monomorphic, irregularly branched,
From Greek
Identification of
Australia: Norfolk Island: Mount Pitt Reserve, Filmy Fern Trail, off Selwyn Pine Road,
Australia: New South Wales: Merrits Creek 3 km east of Mt. Kosciuszko, 1870 m, 9 Feb 1978,
Forming pure turfs or mats of shoots, dark brown in herbarium; shoot systems regularly pinnately branched, with additional pseudodichotomous branching in female plants due to production of pairs of subfloral innovations below gynoecia; dimorphic, primary shoots 1.5–1.8 mm wide and up to 40 mm long, secondary shoots smaller in stature than parent shoot, 0.8–1.0 mm wide, and either apparently terminating growth after 4 to 7 leaf pairs, or producing reproductive structures and, in female plants, continuing vegetative growth; older shoot sectors retaining leaf-lobes.
Stems 120–160 µm diameter, with cortical cells in a single tier of 23–29 rows, cortical cell walls yellow-brown pigmented, external free cortical cell wall continuously thickened, radial longitudinal cortical walls thin or slightly thickened, inner tangential walls thickened; medulla cells in 23–45 rows, medulla cell walls faintly yellow-pigmented, thin walled, small triangular trigones, medial walls unthickened. Cortical cells on dorsal stem surface arranged in straight longitudinal rows on young and mature shoot sectors. Leaf insertion reaching dorsal stem mid-line, leaving no dorsal cortical cell rows leaf-free; leaf insertion not attaining the ventral stem mid-line, leaving two ventral cortical cell rows leaf-free. Leaf lobes rotund, 475–920 µm long by 400–780 μm wide, contiguous, not falcate, acroscopic base not sharply deflexed away from stem, weakly concave, not or weakly interlocking over the dorsal stem surface, stem visible between leaf lobes in dorsal view; margins entire or crenulated, not repand, the interior lobe margin shallowly ampliate, reaching the opposite stem margin, antical and exterior margins more or less continuously curved, postical margin shallowly curved or straight; angle between postical lobe margin and keel 140–180°. Lobules quadrate on leading shoots, one sixth to one quarter the lobe area, 330-605 µm long by 370–595 μm wide; keel straight to shallowly curved, angle between keel and stem 100–135°, keel turning through up to 30°, keel apex and postical lobe margin flush; interior lobule margin free for one quarter to one third its length, free portion ampliate, extending half way across the ventral stem surface or more; acroscopic margin S-shaped to straight, apical portion slightly inclined toward stem or perpendicular to it; apex obtuse but usually weakly apiculate; free exterior margin straight, margins plane, entire; lobe-lobule junction level with or slightly postical to the acroscopic end of stem insertion; attached to stem along 0.66–0.75 of the interior margin, stem insertion gently curved, not revolute; lobule apex bearing a single papilla, another two papilla situated on the interior lobule margin above the stem insertion. Leaf lobe cells rounded-oblong, not arranged in rows, unequally sized, 13–35 µm long by 11–21 μm wide, thin-walled with small triangular trigones, medial wall thickenings absent; cells of lobe margin smaller than those of leaf middle, quadrate to rectangular, 11–18 µm long by 9–13 µm wide, interior walls moderately and continuously thickened, exterior wall moderately and differentially thickened at mid-wall, forming a conspicuous bulge and imparting a crenulate appearance to lobe margin; leaf lobe cell surface unornamented, smooth. Oil-bodies 2 or 3, light brown, granular, internally homogeneous, filling the cell lumen. Asexual reproduction absent. Dioicous. Androecia on branches that usually terminate after production of 4 or 5 pairs of antheridial bracts, but rarely branches indeterminate, bearing ∞ pairs of antheridial bracts; lobules epistatic, keel deeply curved, bucket-like, free apical portion triangular, apex acute, interior margin ampliate, covering ventral stem surface, and imbricate with adjacent antheridial lobules; lobes rounded, not caducous, antheridia not seen. Gynoecia terminal on branch shoots, subtended by two or three subfloral innovations that are full-sized and again fertile; archegonia 125–150 µm tall, archegonia neck five cell columns, 10 per gynoecium on a small disc of tissue, encompassed by a low protoperianth; female bracts in one pair, symmetrical, tightly imbricate, elliptic-obovate, weakly falcate, lobe 690–770 μm long by 430–535 μm wide, margins crenulate; lobules rectangular, one half to two thirds the lobe area, apex obtuse, keel straight to arched, margins crenulate; bract insertion lines interlocking dorsally and ventrally, insertion equitant. Perianths 4200–4700 µm long and 1050–1200 µm wide at mouth, mouth entire to irregular, parallel sided for upper two thirds, widening to flask shaped, faint bulb in basal third, broadest in middle of this bulb, 1200–1350 µm wide, then tapering to base. Perianth walls unistratose above, with bistratose bands extending up to half way up perianth, increasing in width toward base, becoming confluent, basal perianth walls progressively increasing in thickness, 2–3-stratose. Long stem perigynium present, 5-6 stratose, cell walls heavily thickened and brown-pigmented. Calyptral perigynium present, base of calyptra 2–4 stratose at base, strata progressively lost, unistratose above, unfertilised archegonia elevated on surface of calyptra.
Australian.
Individuals vary in branching density, New Zealand plants are typically densely branched, and this also occurs in Australia. Openly branched individuals typically have larger shoots and correspondingly larger lobules that produce more pronounced acuminate lobule apices. These differences may be associated with both patch age and microsite. Shoots colonizing naked rock are always openly branched. Those growing in bryophyte turfs on soil are often closely branched.
One of the first clues to the identity comes from the habitat and microhabitat occupied by
Two related species, also members of the
In New Zealand,
Australia: New South Wales: Southern Tablelands, Mount Kosciuszko National Park, Main Range track to Kosciuszko summit from Charlotte Pass,
Australian Capital Territory: 36 km SSW of Capital Hill, Canberra, Tower 2.5 km north of Orroral Tracking Station,
Victoria: Mt McKay, Alpine National Park, 16 km SSE of Mount Beauty,
Tasmania: Ben Lomond, Hamilton Crags,
New Zealand: South Island: Nelson, Kahurangi National Park, Cobb Valley, between Cobb Lake and Round Lake,
Australia: Tasmania: “ Van Diemen’s Land ”. Syntypes: Voyage of HMS Erebus & Terror.
Type: Australia: Cambewarra Mountain, 1903, leg.
[from NY00831294 and MEL38047] Forming interwoven mats of shoots, brown in herbarium, shoot systems regularly pinnately branched, with additional pseudodichotomous branching due to production of pairs of subfloral innovations below gynoecia; dimorphic, primary shoots 1.2–1.7 mm wide and up to 40 mm long, secondary shoots smaller in stature and either apparently terminating growth after five to seven leaf pairs, or continuing vegetative growth and attaining similar stature to primary shoots by fourth to sixth pair of leaves; older shoot sectors retaining leaf-lobes.
Stems 130–155 µm diameter, with cortical cells in a single tier of 25–31 rows, medulla cells in 20–35 rows, cortical cell walls yellow-brown pigmented, ventral cortical walls occasionally yellow pigmented, external free cortical cell wall continuously thickened, radial longitudinal cortical walls thin or slightly thickened, inner tangential walls continuously thickened; medulla cell walls faintly yellow-pigmented, with small triangular trigones, walls between trigones lacking thickenings; cortical cells on dorsal stem surface arranged in straight longitudinal rows on young and mature shoot sectors. Leaf insertion variable within single individuals, reaching the dorsal stem mid-line or not, leaving zero to three dorsal cortical cell rows leaf-free, dorsal leaf-free strip usually present; leaf insertion not attaining the ventral stem mid-line, leaving two to five ventral cortical cell rows leaf-free. Leaf lobes rotund-ovate, 600–845 µm long by 400–655 μm wide, contiguous, not to weakly falcate, acroscopic base not sharply deflexed away from stem, plane, not interlocking over the dorsal stem surface, stem visible between leaf lobes in dorsal view; margins irregularly but minutely repand, otherwise entire, the interior lobe margin shallowly ampliate, not or only just reaching the opposite stem margin, antical margin curved, exterior margin sharply curved through nearly 100°, postical margin shallowly curved or straight; angle between postical lobe margin and keel c. 135°. Lobules quadrate to rhombic when small and large, one eighth to one sixth the lobe area, 310–475 µm long by 215–420 μm wide; keel curved in small stature lobules, to straight, to arched in large stature lobules, angle between keel and stem 135°, keel turning through 90° mostly at keel-lobe junction, keel apex and postical lobe margin with shallow notch; interior lobule margin free for one third its length, free portion weakly ampliate small stature lobules to moderately ampliate on large stature lobules, extending at most half way across the ventral stem surface; acroscopic margin S-shaped (typical in situ) to straight (when flattened), apical portion inclined toward stem; apex obtuse to acute; free exterior margin straight to curved, occasionally with a small knee above the lobe-lobule junction; margins plane, entire or shallowly repand; lobe-lobule junction slightly antical to, or level with, the acroscopic end of stem insertion; attached to stem along 0.66 of the interior margin, stem insertion more or less linear, gently curved at acroscopic and basiscopic ends, not revolute; lobule apex bearing a single papilla, with another two papilla situated on the interior lobule margin above the stem insertion. Leaf lobe cells rounded-oblong, not arranged in rows, unequally sized, 10–23 µm long by 11–19 μm wide; thin walled with small triangular trigones, medial wall thickenings absent; cells of lobe margin smaller than those of middle, quadrate to rectangular, 9–15 µm long and wide, interior and exterior cell walls not differential thickened, cell lumen not bulging medially, leaf lobe cell surface unornamented, smooth. Oil-bodies not known. Asexual reproduction absent. Dioicous. Androecia on lateral branches that usually terminate following production of 2–4 pairs of antheridial bracts, occasionally these branches continue vegetative growth; bract lobules epistatic, keel deeply curved, bucket-like, free apical portion triangular, apex obtuse, inner margin ampliate, plane; lobes rounded, not caducous; antheridia 1–2 per bract. Gynoecia terminal on leading shoots, subtended by two subfloral innovations, usually full-sized and again fertile; archegonia 130–155 µm tall, archegonia neck six cell columns, 6–8 per gynoecium, on a small disc of tissue, interspersed with paraphyses of 1–3 moniliform cells capped by a hyaline papilla, not encompassed by a protoperianth. Female bracts in one pair, symmetrical, tightly imbricate, elliptic-obovate, weakly falcate, lobe 725–845 μm long by 390-610 μm wide, margins entire; lobules rectangular, one half the lobe area, apex obtuse to broadly acute, keel arched, margins entire; bract insertion lines interlocking dorsally and ventrally, insertion equitant. Perianths 2670–3650 µm long and 630–930 µm wide at mouth, mouth repand, more or less parallel sided for upper third, then tapering to tubular stem perigynium comprising the lower third to half, faint bulb in basal third, broadest c. one third from mouth where 660–950 µm wide, walls bi- or tri-stratose at junction with perigynium, unistratose above, cell walls with triangular trigones. Long stem perigynium present, 5-6 stratose throughout, cell walls not thickened or brown-pigmented, hyaline, perianth-calyptra junction elevated above female bracts on 9–15 tiers of cells. Calyptral perigynium present, 2–4 stratose at base, unistratose above, unfertilised archegonia elevated on surface of calyptra.
Horn-bearing.
Casual field observation suggests the elevational range occupied by
The ecological range decreases with latitude; the further north, the more restricted to foothills, escarpments, and mountains in association with cool temperate rainforests. This altitudinal contraction is associated with restriction in the diversity of microhabitats occupied, such that at the northern end of its range, where
Individual populations exhibit generous amplitude in shoot stature and lobule shape. Lobules vary from rhombic-quadrate with little ampliation of the interior margin and a straight antical margin, to quadrate with a pronounced ampliate interior margin and an S-shaped antical margin having a distinct, obtuse, lobule apex. Colour of individuals varies, from glaucous yellow-green to dark green, in part this appears correlated to microhabitat, with epiphytic plants tending yellow green, and lithophytic plants being dark green.
The amplitude of morphological variation expressed between individuals appears negatively correlated with latitude. The greatest morphological variation between individuals in plant colour, shoot size and lobule shape occurs in the southern end of the distribution. Individuals vary from brown-green, mid-green and glaucous green and from small to large, with associated differences in lobule shape. In Central and Northern Coast, and Northern Tableland regions in the northern part of
The name
Castle, however, appears to have been hopelessly confused regarding the identity of
Yamada (1984) synonymised
Australia: New South Wales: Northern Tablelands, The Cascades, Point Lookout, New England National Park,
Victoria: Wilsons Promontory, headwaters of Blackfish Creek, Wilsons Promentory National Park,
Tasmania: Furneaux Group, Flinders Island, 660 m east of summit of Big Badger Hill,
Western Australia: Mt Chudalup, 17 km SSE of Northcliffe,
New Zealand, North Island, Puaiti Bush south of Rotorua, ca 1,600 ft, 20 Jun 1931,
Type. New Zealand: North Island: ‘Epiphytical on fronds of
Similar to
From Latin
South-eastern Australia in Victoria and Tasmania, and New Zealand. On mainland Australia
In New Zealand
In forests
In subalpine scrub
Included within
The existence of subtly different, ecologically distinct, alpine plants of
Despite being confused with a range of related and unrelated species,
In Australia,
The lobule keel differs between
If these more accessible characters prove ambiguous, diagnostic differences can be derived by counting the number of rows of dorsal cortical cells that are not crossed by the leaf insertion lines. In
In alpine environments,
Perianth morphology may lead to confusion between
In Australia
Colenso’s description of a bipinnately branched plant with dimorphic shoots, ‘peduncled’ perianths with a truncate mouth with slightly uneven labia, and subtended by two divergent subfloral innovations, growing epiphytic on
New Zealand, North Island: Te Paki Ecological Region and District, Te Paki, Radar Bush,
Chatham Islands: Chatham Island, Waitangi, Crispans Lane, Unnamed Stream,
Australia: Victoria: Otway Range, Carslisle State Park, Carlisle-Gellibrand Road,
Tasmania: New Norfolk Municipality, tributary of the Styx River 10 miles west of Maydena,
Similar to both
Australia: Queensland: Cook, Daintree National Park, Mount Lewis, headwaters of Leichhardt Creek flowing down the south-west flanks of the summit, epiphyllous on
[From NSW896812] Forming tufts of overlapping and interlocking shoots on leaves and twigs, bright- to mid-green when fresh, fading to a glossy tan or brown in herbarium; shoot systems densely irregularly pinnately branched in female plants, with additional pseudodichotomous branching in fertile female plants due to production of pairs of subfloral innovations below gynoecia; monomorphic, 0.8–1.2 mm wide and up to 30 mm long, branches smaller in stature than parent shoot; older shoot sectors retaining leaf-lobes. Stems 80–130 µm diameter, with cortical cells in a single tier of 15–30 rows; cortical cell walls yellow-brown to brown pigmented; external free cortical cell wall heavily and continuously thickened, radial longitudinal cortical walls thickened or not, inner tangential wall more or less continuously thickened; medulla cells in 10–25 rows; cell walls yellow-brown pigmented, with medium-sized triangular to weakly bulging trigones, walls between trigones lacking thickenings or continuously thickened; cortical cells on dorsal stem surface arranged in straight longitudinal rows on young and mature shoot sectors. Leaf insertion reaching dorsal stem mid-line or not, leaving zero or one dorsal cortical cell rows leaf-free, in some shoots stem growth appears to have introduced an additional cortical cell row to the dorsal stem surface, in which case a single row of dorsal cortical cells is leaf-free, but this row is discontinuous between adjacent leaf pairs; leaf insertion not attaining the ventral stem mid-line, leaving two to four ventral cortical cell rows leaf-free. Leaf lobes elliptic-ovate, 430–700 µm long by 320–450 μm wide, larger on primary shoots, contiguous to imbricate, not to weakly falcate, acroscopic base not sharply deflexed away from stem, flat, patent, not interlocking over the dorsal stem surface, stem visible between leaf lobes in dorsal view; margins irregularly but minutely repand, crenulated due to medial wall thickenings on marginal cell walls, the interior lobe margin weakly ampliate, covering part of the dorsal stem surface but not often reaching the stem midline, and never exceeding the opposite stem margin, antical margin curved, exterior margin curved, postical margin curved to straight; angle between postical lobe margin and keel 45-60°. Lobules rhombic when small to almost quadrate, one sixth the lobe area, 175–345 µm long by 150–265 μm wide, larger on leading shoots; keel straight to curved, angle between keel and stem 135°, keel apex and postical lobe margin running into lobe margin smoothly or shallowly notched; interior lobule margin free for one eighth to one sixth its length, free portion not or weakly ampliate, not or hardly extending onto the ventral stem surface; acroscopic margin shallowly S-shaped, apical portion inclined towards stem; apex apiculate-rounded; free exterior margin straight to curved, margins plane, entire; lobe-lobule junction level with the acroscopic end of stem insertion in small and large lobules; attached to stem along 0.83 to 0.88 of the interior margin, stem insertion straight to curved, not revolute at acroscopic end; lobule apex bearing a single papilla, with another two papilla situated on the interior lobule margin above the stem insertion. Leaf lobe cells rounded-oblong, not arranged in rows, unequally sized, 11–22 µm long by 8–16 μm wide, walls slightly thickened their entire length, sometimes with small triangular trigones, medial wall thickenings absent; cells of lobe margin smaller than those of leaf middle, quadrate to rectangular, 9–14 µm long and wide, interior walls not differentially thickened, exterior walls with pronounced medial thickening, and medially bulging cell lumen; leaf lobe cell surface papillose, upper lobe wall differentially thickened over cell lumen forming a single low dome-shaped papilla over each cell. Oil-bodies not known. Asexual reproduction not known. Dioicous. Androecia not known. Gynoecia terminal on leading shoots, subtended by two subfloral innovations that are full-sized and again fertile; archegonia 145–160 µm tall, archegonia neck five or six cell columns, 6–8 per gynoecium on a small disc of tissue, encompassed by the protoperianth; female bracts in one pair, slightly asymmetrical with lobule on one larger than the other, imbricate, elliptic-ovate, lobe 520–570 μm long by 240–320 μm wide, margins irregular and crenulate; lobules rectangular-ovate, one half to two thirds the lobe area, apex rounded to obtuse, keel arched, irregular.
Known to date from four specimens, all growing over running streams on either leaves or bark including tree-trunks and branches. The specimens were collected in the North Coast of New South Wales, and in the Wet Tropics Bioregion of north-east Queensland.
Within its already reduced size, in comparison to its relatives,
Australia: New South Wales: North Coast, Dorrigo National Park, Rosewood River, Rosewood Creek Track, Oreocallis Gully,
Australia: Zaintree River [orthographical corruption of Daintree River],
[From NSW897201] Forming extensive pure sheets of interwoven pendulous shoots on tree trunks and rocks; living plants opaque yellow-green to glaucous brown-green, fading to milky pale-brown in herbarium; shoot systems regularly pinnate, subdimorphic, with shoots 1.6–2.5 mm wide and up to 80 mm long, branches typically slightly smaller in stature than parent shoot; older shoot sectors becoming ragged in appearance due to irregular leaf fragmentation. Stems 190–250 µm diameter, with cortical cells in a single tier of 30–50 rows; cell walls brown pigmented throughout; cortical cell walls heavily and continuously thickened, at times constricting the cell lumen, dorsally arranged in an oblique zig-zag on young shoot sectors, cell elongation somewhat obscuring this pattern in mature shoot sectors; medulla cells in 80–110 rows, cell walls heavily thickened with coarse nodular trigones that become confluent, and constrict the cell lumen, thin walls occasional. Leaf insertion exceeding dorsal stem mid-line, insertion lines interlocking over two dorsal cortical cell rows, dorsal leaf-free strip absent. Leaf lobes oblong-falcate, 770–1360 µm long by 560–870 µm wide, contiguous to weakly imbricate, acroscopic base sharply deflexed away from stem, otherwise leaves weakly convex, not interlocking over the dorsal stem surface, stem visible in dorsal view, margins may be irregular in outline but always entire, the interior lobe margin curved, not auriculate, antical margin shallowly curved, exterior margin broadly rounded, postical margin straight or substraight. Lobules on leading shoots typically one quarter the lobe area, more or less quadrate, 430–720 µm long by 510–750 µm wide, keel straight to shallowly arched, angle between keel and stem 135°, keel turning through 45–55° at the apex; interior free margin weakly ampliate, acroscopic margin straight or shallowly arched, usually more or less perpendicular to shoot axis, and apices obtuse or broadly acute; attached to stem along 0.4–0.5 of the interior margin, stem insertion gently S-shaped but abruptly revolute at acroscopic end; lobule apex bearing a single papilla, with another papilla situated on the interior lobule margin above the stem insertion; lobules on leading shoots typically larger than those on branches, lobules on branches more rhomboid than quadrate, one fifth to one quarter the lobe area, keel shallowly arched to straight to slightly curved, angle between keel and stem 135°, keel turning through 45–55° at the apex, interior free margin weakly ampliate, acroscopic margin typically S-shaped to shallowly arched, inclined to shoot axis, apex typically broadly acute. Leaf lobe cells rotund to rounded-oblong, 19–28 µm long by 15–23 µm wide, thin walled with concave to triangular trigones, medial wall thickenings absent; cells of lobe margin smaller than those of leaf middle, quadrate to rectangular, 10- 15 µm long by 7–11 µm wide, long axis orientated parallel to lobe margin, exterior cell walls each with a medial wall thickening that bulges into the cell lumen margin; cell surface weakly bulging, bearing heavy verrucose ornamentation. Oil-bodies not known. Asexual reproduction by caducous leaf lobes, sporadic, typically but not always on old shoot sectors, fragmentation scars irregular, shoot primordia forming as irregular buds on leaf lobe margins in older shoot sectors prior to leaf fragmentation. Dioicous. Androecia on lateral branches that continue vegetative growth, androecial bracts in 3–5 pairs, smaller than vegetative leaves, lobes 510–660 µm long and 360–430 µm wide, ovate, imbricate, lobules hypostatic, keel deeply curved, bearing 1–2 antheridia each. Gynoecia terminal on axes, with one pair of female bracts subtended by one (on branches) or two (on leading shoots) full sized subfloral innovations that may again be fertile; archegonia 160–200 µm tall, archegonia neck five cell tiers, cells regularly arranged, 18–20 per gynoecium on a small raised disc of tissue encompassed by the base of the protoperianth; female bracts equal, ovate-falcate, lobes 1200–1310 µm long by 685–870 µm wide, lobules ovate, one half the lobe area, apex rounded to obtuse, keel strongly arched, insertion interlocking both dorsally and ventrally, insertion equitant. Perianths 3000–3500 µm long and 800–900 µm wide at mouth, cyathiform, flaring widely from a narrow base, which is a low stem perigynium 4–5 stratose with brown-pigmented walls, broadest immediately above base, straight-sided, gradually tapering to the mouth, which has irregularly sinuous labia; perianth walls 2–3 stratose at base, unistratose above; calyptral perigynium present, unfertilised archegonia ‘riding’ onto base of calyptra, calyptra 2–3 stratose at base, tapering to unistratose above.
Named for William Mitten (1819–1906) pharmaceutical chemist and bryologist, contemporary of and collaborator with W.J. and J.D. Hooker, father-in-law to Alfred Russell Wallace; and author of the first floristic treatment of liverworts of New Zealand in Hooker’s Handbook of the New Zealand flora.
In Australia
Within individuals the dimorphic nature of shoot systems means lobules on primary shoots differ in size and shape from those on secondary shoots, a feature first documented by
Among Australasian
Some forms of
In the protologue of
In this holotype (NY00831342) are three elements: two separate pieces of material and three shoots loose within the packet. These three elements comprise three different
The first element has shoot systems that are sparingly dichotomously branched, and lobules whose interior margin is not ampliate over the stem, and in these characters it does not agree with the protologue.
The second and third elements are pinnately branched, and lobules with inflated base and truncate exterior margins, so agree in some pertinent details with the protologue. However, besides the description of shoot length, the protologue is insufficiently detailed to discriminate between elements two and three. Element two has shoots approaching 50 mm long which element 3 does not.
Of the three elements only two, the first and second, are known to occur in the vicinity of the Daintree River. The third is a southern temperate species whose northern limit is somewhere in the vicinity of the Clarence River, northern New South Wales.
As there is not much basis, beyond shoot length, for selecting between elements 2 and 3 given the protologue, Article 9, Recommendation 9A.4 of the ICN could be invoked, to preserve current usage of the name
Of the other elements, the first corresponds to
The origin of these three loose
Australia, Queensland: Cook District, Leo Creek, upper Nesbit River,
Australia: Queensland: Cook, Wooroonooran National Park, tributary of Babinda Stream 30 m above junction with Babinda Stream, forming conspicuous patches of pendant, procumbent, brown-green shoots on trunk of
[From NSW909500, NSW909501 and BRI-AQ722865] Forming loosely interwoven mats on tree trunks, branches and twigs, either tightly adherent on or hanging from substrate. Live plants nitid brown-green, fading to brown in herbarium. Shoot systems irregularly and often infrequently branched, female plants predominantly pseudodichotomous due to production of pairs of subfloral innovations below gynoecia. Shoot systems monomorphic, 1.4–2.0 mm wide and up to 40 mm long, branches initially smaller in stature than parent shoot but attaining similar stature by fourth of fifth pair of leaves. Older shoot sectors retaining leaf-lobes, though older leaf lobes may partially fragment on some shoots. Stems 135–160 µm diameter, with cortical cells in a single tier of 14–26 rows; outer half brown-pigmented, inner half tan-pigmented; external free cortical cell wall heavily and continuously thickened, radial longitudinal cortical walls thin or slightly thickened, inner tangential walls heavily and more or less continuously thickened by fusion coarse nodular trigones; medullar cells in 15–32 rows, with coarse nodular trigones, lacking thickenings between trigones, occasionally with heavily and continuous thickenings, all unpigmented or faintly yellow pigmented. Cortical cells on dorsal stem surface arranged in straight longitudinal rows on young and mature shoot sectors. Leaf insertion not reaching dorsal stem mid-line, leaving one or two dorsal cortical cell rows leaf-free; leaf insertion not attaining the ventral stem mid-line, leaving two ventral cortical cell rows leaf-free. Leaf lobes rotund-elliptic to elliptic-oblong, 950–1145 µm long by 610–820 μm wide, contiguous to imbricate, not falcate, acroscopic base not sharply deflexed away from stem, plane, not interlocking over the dorsal stem surface, stem visible between leaf lobes in dorsal view; lobe margins irregular and crenulate, the interior lobe margin sometimes minutely auriculate, not or only just reaching the opposite stem margin, antical margin shallowly curved, becoming substraight in larger leaf lobes, sharply curved through nearly 90° in exterior quarter, exterior margin shallowly curved or straight, sharply curved through nearly 90° in postical quarter, postical margin straight; angle between postical lobe margin and keel c. 135°. Lobules rhombiform when small, transitional as stature increases to trapeziform with exterior and interior margins nearly parallel, one sixth to one fifth the lobe area, 370–735 µm long by 260–480 μm wide, keel straight in rhombiform lobules, arched in trapeziform lobules, angle between keel and stem 135°, keel gradually turning through 90°, keel apex and postical lobe margin flush, interior lobule margin free for one quarter to one third its length, free portion weakly ampliate on rhomboid lobules to moderately ampliate on trapeziform lobules, extending at most half way across the ventral stem surface, acroscopic margin S-shaped to curved, apical portion inclined toward stem in smaller lobules, transitional to perpendicular to stem axis in larger lobules, apex acute in rhomboid lobules transitional to obtuse in trapeziform lobules, free exterior margin straight to shallowly curved, occasionally with a small knee above the lobe-lobule junction, margins plane, crenulate; lobe-lobule junction antical to the acroscopic end of stem insertion, lobule attached to stem along 0.66–0.75 of the interior margin, stem insertion more or less linear, gently curved at acroscopic and basiscopic ends, not revolute; a single papilla present at the lobule apex and another two papilla situated on the interior lobule margin above the stem insertion. Leaf lobe cells rounded-oblong, not arranged in rows, unequally sized, 16–26 µm long by 11–19 μm wide, thin walled with triangular trigones, medial wall thickenings absent; cells of lobe margin smaller than those of leaf middle, quadrate to rectangular, 9–15 µm long and wide, interior cell walls evenly and continuously thickened, exterior cell wall thickened differentially at midwall, causing exterior margin to be crenulated, cell lumen not bulging medially; leaf lobe cell surface unornamented, smooth. Oil-bodies not known. Asexual reproduction possibly by caducous leaf lobes but sporadic, older shoot sectors usually retaining most or all of their leaf-lobes, with fragmenting leaf-lobes tearing into several pieces, fragmentation scars jagged, irregular, typically leaving part of basiscopic leaf margin attached beyond keel, shoot primordia forming as irregular buds on leaf lobe after leaf fragmentation. Dioicous. Androecia on indeterminate branches that continue vegetative, androecial bracts in 4–8 pairs, lobules epistatic, keel deeply curved, bucket-like, free apical portion triangular, apex obtuse, moderately deflexed, lobes rounded, not caducous, antheridia not seen. Gynoecia terminal on leading shoots and branches, subtended by one or two full sized subfloral innovations that are again fertile, where a single subfloral innovation is present, a ‘resting’ shoot primordium occurs in place of the second subfloral innovation; archegonia 140–170 µm tall, up to 16–18 per gynoecium on a small raised disc of tissue, encompassed by the protoperianth, archegonia neck eight cell columns; female bracts in one pair, asymmetrical, tightly imbricate, oblong-obovate, larger lobe 665–720 μm long by 440–475 μm wide, smaller lobe 620–650 μm long by 350–370 μm wide, lobules rectangular, one half the lobe area, apex obtuse to broadly acute, keel arched, margins crenulate, insertion interlocking dorsally but not ventrally, insertion equitant. Perianths 2800–3800 µm long, conical and flared at mouth, mouth irregularly repand 880–950 µm wide. Perianth walls unistratose above, with bistratose bands extending up to half way up perianth, increasing in width toward base, becoming confluent, basal perianth walls progressively increasing in thickness, 2–3 stratose. Long stem perigynium present, 5-6 stratose, external cell wall thickened and brown-pigmented, internal walls unthickened and unpigmented. Calyptral perigynium present, base of calyptra bistratose at base, unistratose above, unfertilised archegonia elevated on surface of calyptra.
From Latin
Beyond variation in shoot stature and associated size related changes in lobule shape,
Australia: Queensland: Cook District, Babinda Creek, ca 1000 ft, 20 July 1983,
Australia: New South Wales: Central Tablelands, Small gully near Wonga Falls on Lamonds Creek, Barren Ground Nature Reserve,
[From NSW770504] Forming loosely interwoven mats of adherent shoots on soil and rock; live plants unknown, brown in herbarium; shoot systems monomorphic, 1.0–1.5 mm wide and up to 40 mm long, irregularly branched, though female plants predominantly pseudodichotomous due to production of pairs of subfloral innovations below gynoecia, branches initially smaller in stature than parent shoot but attaining similar stature to parent shoot by second or third pair of leaves; older shoot sectors retaining leaf-lobes. Stems 110–140 µm diameter, with cortical cells in a single tier of 19–25 rows, cortical cell walls yellow-brown pigmented, all walls heavily and continuously thickened, partially constricting individual cell lumen; medullar cells in 12–17 rows, medulla cell walls yellow-pigmented, continuously and heavily thickened, somewhat more so at cell junctions; cortical cells on dorsal stem surface arranged in straight longitudinal row on young and mature shoot sectors. Leaf insertion not reaching dorsal stem mid-line, leaving one to three dorsal cortical cell rows leaf-free; leaf insertion not attaining the ventral stem mid-line, leaving four or five ventral cortical cell row leaf-free. Leaf lobes ovate, 620–860 µm long by 500–700 μm wide, imbricate, weakly falcate or not, acroscopic base plane, not sharply deflexed away from stem, not interlocking over the dorsal stem surface, stem visible between leaf lobes in dorsal view, margins entire, the interior lobe margin weakly ampliate, not auriculate, not or only just reaching the opposite stem margin, more or less straight in larger lobes, sometimes with a single triangular tooth near the stem insertion, more often in smaller lobes, antical margin continuously curved, exterior margin curved, postical margin straight or slightly curved; angle between postical lobe margin and keel 100–135°. Lobules rhombic to trullate, one eighth to one seventh the lobe area, 240–485 µm long by 185–310 μm wide, keel slightly curved or straight, angle between keel and stem 100–135°, keel apex and postical lobe margin weakly notched, inner lobule margin free for one half to two thirds its length, free portion not ampliate, not extending across stem beyond insertion line, acroscopic margin straight to weakly curved, apex narrowly rounded to acute, free exterior margin straight, occasionally with a small knee above the lobe-lobule junction, margins plane, entire; lobe-lobule junction postical to the acroscopic end of stem insertion, attached to stem along 0.33–0.5 of the interior margin, stem insertion gently curved its entire length, not revolute; lobule apex bearing a single papilla, no other papilla, or papilla scars, observed on the interior lobule margin. Leaf lobe cells hexagonal-oblong, not arranged in rows, unequally sized, 11–21 µm long by 10–12 μm wide, walls moderately and continuously thickened. Cells of lobe margin smaller than those of leaf middle, quadrate to rectangular, 6–12 µm long by 6–10 µm wide, interior cell walls evenly and continuously thickened, exterior cell wall unthickened. Leaf lobe cell surface unornamented, smooth. Oil-bodies not known. Asexual reproduction absent. Dioicous. Androecia on short lateral branches or terminal on leading shoots, either terminating following androecia production, or continuing vegetative growth; antheridial bracts in 3–4 pairs; lobules epistatic, keel deeply curved, bucket-like, free apical portion triangular, apex acute, plane, lobes rounded, not caducous; antheridia not seen. Gynoecia terminal on leading shoots and branches, subtended by one or two full sized subfloral innovations that are again fertile, more often subtended by a single subfloral innovations on branches with a ‘resting’ shoot primordium in place of the second subfloral innovation. Archegonia 175–190 µm tall, archegonia neck five or six cell columns, 12–14 per gynoecium on a small raised disc of tissue, encompassed by the protoperianth, with several large single celled or stalked (on 2 or 3 cells) papillae scattered among gynoecia. Female bracts three, symmetrical, imbricate, obovate-falcate, lobe 1140–1255 μm long by 670–795 μm wide, lobules triangular, one half the lobe area, 585–930 μm long by 340-645 μm wide apex acute, keel arched, margins entire, insertion interlocking dorsally and ventrally, insertion equitant. Perianths and sporophytes not known.
From Latin
Within individuals, shoot stature varies, and this is correlated with changes in lobule shape, which tend to be shorter on smaller shoots.
Other diagnostic differences between
Female bract number suggests this species belongs to subg.
New South Wales, Southern Tablelands, Tumbarumba District, November 1900,
[From CHR579214] Forming interwoven mats of shoots, glaucous yellow-green to brown-green in life, brown in herbarium; shoot systems regularly pinnately branched in male plants and sterile female plants, but pseudodichotomous in fertile female plants due to production of pairs of subfloral innovations below gynoecia, monomorphic, 1.0–2.0 mm wide and up to 40 mm long, branches initially smaller in stature than parent shoot and attaining similar stature by third to fifth pair of leaves; older shoot sectors retaining leaf-lobes. Stems 115–175 µm diameter, with cortical cells in a single tier of 16–25 rows, cell walls yellow-brown to brown pigmented, external free cortical cell wall heavily and continuously thickened, radial longitudinal walls thin, inner tangential walls thin or continuously thickened; medulla cells in 18–35 rows, cell walls yellow-brown pigmented, sometimes deepening to brown pigmented on old shoot sectors, cell walls with small triangular trigones, walls between trigones lacking thickenings. Cortical cells on dorsal stem surface arranged in straight longitudinal rows on young and mature shoot sectors. Leaf insertion not reaching dorsal stem mid-line, leaving four or five dorsal cortical cell rows leaf-free; leaf insertion not attaining the ventral stem mid-line, leaving two or three ventral cortical cell rows leaf-free. Leaf lobes elliptic-ovate, 550–1050 µm long by 400–830 μm wide, remote to contiguous, not falcate, acroscopic base not sharply deflexed away from stem, flat, lying in plane with stem, not interlocking over the dorsal stem surface, stem visible between leaf lobes in dorsal view; margins irregularly but minutely repand, minutely crenulate, the interior lobe margin not or at most shallowly ampliate, hardly covering the dorsal stem surface and not reaching the opposite stem margin, antical margin curved, exterior margin curved through nearly 100°, postical margin straight; angle between postical lobe margin and keel c. 135°. Lobules quadrate when small to oblong, one twelfth to one sixth the lobe area, 270–490 µm long by 140–270 μm wide; keel straight to shallowly arched, angle between keel and stem 135–150°, keel turning through 90° at keel-lobe junction, keel apex and postical lobe margin flush; interior lobule margin free for one fifth to one quarter its length, free portion not ampliate in small stature lobules to moderately ampliate on large lobules, extending at most half way across the ventral stem surface; acroscopic margin S-shaped, apical portion perpendicular to stem; apex obtuse to apiculate; free exterior margin straight, margins plane, crenulated; lobe-lobule junction well postical to the acroscopic end of stem insertion; attached to stem along 0.75 to 0.8 of the interior margin, stem insertion more or less straight, not curved at acroscopic or basiscopic ends, not revolute; lobule apex bearing a single papilla, with another two papilla situated on the interior lobule margin above the stem insertion. Leaf lobe cells rounded-oblong, not arranged in rows, unequally sized, 10–25 µm long by 9–19 μm wide, thin walled with small triangular trigones, medial wall thickenings absent; cells of lobe margin smaller than those of leaf middle, quadrate to rectangular, 9–15 µm long and wide, interior and exterior cell walls not differential thickened, cell lumen bulging medially; leaf lobe cell surface unornamented, smooth. Oil-bodies two or three per cell, ellipsoidal, filling cell lumen, light-brown, surface granular, internally homogeneous or with a hyaline droplet. Asexual reproduction usually absent, however two specimens have been observed producing bud-like shoot primordia from leaf lobe margins. Dioicous. Androecia on indeterminate branches that continue vegetative or reproductive growth, androecial bracts in 4-∞ pairs, lobules epistatic, keel deeply curved, bucket-like, free apical portion triangular, apex obtuse, moderately deflexed, lobes rounded, not caducous, antheridia not seen. Gynoecia terminal on leading shoots, subtended by two full subfloral innovations that are usually full-sized and again fertile; archegonia 130–155 µm tall, archegonia neck five or six cell columns, 6–8 per gynoecium on a small disc of tissue, not encompassed by the protoperianth; female bracts in one pair, slightly asymmetrical, tightly imbricate, elliptic-ovate, weakly falcate, lobe 840–1015 μm long by 460–545 μm wide, margins entire; lobules rhomboid to trullate, one quarter to one half the lobe area, apex acute to acuminate, keel straight to arched, margins entire; bract insertion lines interlocking dorsally and ventrally, insertion equitant. Perianths 3200–3800 µm long and 840–980 µm at mouth, mouth entire to irregularly lobed, perianth shape variable, either broadening from mouth to widest point at approximately one third to one half length above base, where 850–950 µm wide, then tapering to base, or tapering from mouth to base; perianth walls unistratose above, with bistratose collar 3 or 4 cell tiers high above the perianth-calyptra junction; long stem perigynium present, 5-6 stratose, cell walls not thickened or pigmented, perianth-calyptra fusion elevated above female bracts on 9–15 tiers of cells; calyptral perigynium present, base of calyptra bistratose, unistratose above, unfertilised archegonia elevated on surface of calyptra.
Strangulating, in reference to the entwining growth about a shoot of
When growing on naked bark
Part of the justification presented by
Scatterplot of perianth vs capsule valve length in three individuals of
Despite the variability exhibited by
The most accessible morphological character by which
If this character proves ambiguous, lobule shape is a source of diagnostic differences.
As far as is known,
The plants illustrated for
The specimen of
New Zealand: Kermadec Islands: Raoul Island, Ravine 8, Hebe Site,
Australia: New South Wales: North Coast, Dorrigo National Park, west of Coffs Harbour,
Ignambi on rocks, 3000 ft, New Caledonia, 30 Jul 1914,
The type specimens of
Australia: Norfolk Island: Mt Pitt Road, Mount Pitt Reserve, 230 m,
This study was completed during an Australian Biological Resources Study (ABRS) Postdoctoral Fellowship awarded to M.A.M. Renner, in collaboration with N. Devos, E.A. Brown and the Royal Botanic Gardens & Domain Trust (grant RFL210–36B). We thank curators and staff at herbaria AK, BM, BR, CANB, CHR, DUKE, E, MELB, MO, NY, S, WELT, for loan of specimens included in this study; Zonda Erskine (NSW) for organising loans; Dr David Glenny and two other anonymous reviewers for valuable feedback on all aspects of the manuscript from title to typification; Carolyn Connelly and Margaret Heslewood for assistence in the laboratory; material was collected in this study under permits WITK09628611 (DERM–Queensland), WC-30361-FLO (DoC–New Zealand), FL11079 (DPIPWE–Tasmania), 10005713 (DSE – Victoria), and SL100569 (NPWS– New South Wales). We thank SR David Phillips for organizing our accommodation in the DERM lodge at South Johnston River; staff at ATH herbarium at JCU for drying and shipping herbarium specimens back to NSW, this guaranteed material was suitable for DNA extraction, and their efforts in this regard are greatly appreciated; Cameron Kilgour and Yumiko Baba for accommodation, hospitality, and most of all an invitation to MR to join them in their search for